Gene detail

Detail information of GWHGAAZE028344

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI23554.3	6.18467E-35	unnamed protein product [Vitis vinifera]
COG	YP_001875818.1	0.00000008	serine/threonine protein kinase
Swissprot	tr\|Q8GYA4\|CRK10_ARATH	1E-29	Cysteine-rich receptor-like protein kinase 10 (Precursor)
trEMBL	tr\|U5FNL5\|U5FNL5_POPTR	2E-34	Uncharacterized protein {ECO:0000313\|EMBL:ERP50962.1} (Fragment)
TAIR10	AT4G23180.1	2E-26	cysteine-rich RLK (RECEPTOR-like protein kinase) 10

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	51980229	51981555	+
GWHAAZE00000008	mRNA	51980229	51981555	+
GWHAAZE00000008	exon	51980229	51980475	+
GWHAAZE00000008	exon	51981314	51981555	+
GWHAAZE00000008	CDS	51980229	51980475	+
GWHAAZE00000008	CDS	51981314	51981555	+

Transcript Sequence
>GWHTAAZE028378 ATGGCTGAAGTGGTGGCCTCACTTGAGTGTGCACTGGCGTTGCAAGAGAGAACAGACTCTTCAGTGTTCGATCGTGATCTGTTGAGTATGGGTGGGGATTTTGGCAATCAAGATATTGTCGATTGCTCCTCAGAAAAACCTGAGGTAATCCATTCAGGTAGCAGCGAGCATCATGATGGCAATCAAGAAATTGTGGAATATTCCTCAAAACAACAGGACGTTGTCTACTCGGTAACGGACGGCATAAATCTAGTCAACAGGGCAGATTTGGACTGGGATAGATGCTACAAAATCATTGGAGGTGTTGCTCGGGGACTTCTGTATCTTCATGAGGAATCTCGACCTCGAATTATTCACCGTGATATGCAAGCTAGCAATGTTTTGTTAGATGAAGAGATGAATCCAAAAATTGCATATTTTGGCGTGGCAAGATTTTTTGAAACAGATGAAACCCAAGGCAATACAAGTAGGATTGTGGGGACCCAGTAA

Network for GWHGAAZE028344

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0172	Protein Kinases RLK-Pelle_DLSV family Protein Kinases RLK-Pelle_DLSV GO:0042545 cell wall modification GOslim:biological_process

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	86	161	9.80E-12

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_DLSV

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.873
	SRR3591706	second leaf	0.599
	SRR3591707	mature leaf	1.000
	SRR3591708	Shoot apex	0.882
	SRR3591709	Stem	3.124
	SRR3591710	White floral bud	2.389
	SRR3591711	White flower	4.964
	SRR3591712	Green floral bud	1.944
	SRR3591713	Yellow flower	5.016
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.045
	SRR8316897	Juvenile bud stage	1.034
	SRR8316894	Third green stage	0.013
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.219
	SRR8316903	Complete white stage	0.048
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.023
	SRR8316906	Gold flowering stage	0.100
	SRR8316907	Gold flowering stage	0.103
	SRR8316908	Gold flowering stage	0.853
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.031
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.026
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.120
	CNS0095603	Golden flower (diploid) 3	0.039
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.636
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.456
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.798
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.027
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.057
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.779
	CNS0095610	Silvery flower (diploied) 1	1.213
	CNS0095611	Silvery flower (diploied) 2	1.423
	CNS0095612	Silvery flower (diploied) 3	1.802
	CNS0095613	Golden flower (tetraploid) 1	0.552
	CNS0095614	Golden flower (tetraploid) 2	0.820
	CNS0095615	Golden flower (tetraploid) 3	1.501
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.157
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.020
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.112
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.109
	CRR073319	Tawny withering 2	0.245
	CRR073320	Tawny withering 3	0.101