Gene detail

Detail information of GWHGAAZE028452

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010249552.1	1.79937E-78	PREDICTED: GATA transcription factor 12 [Nelumbo nucifera]
Swissprot	tr\|O82632\|GATA9_ARATH	2E-63	GATA transcription factor 9
trEMBL	tr\|A0A068UI11\|A0A068UI11_COFCA	6E-77	Coffea canephora DH200=94 genomic scaffold, scaffold_31 {ECO:0000313\|EMBL:CDP08170.1}
TAIR10	AT5G25830.1	5E-46	GATA transcription factor 12

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	57255359	57255922	+
GWHAAZE00000008	mRNA	57255359	57255922	+
GWHAAZE00000008	exon	57255359	57255440	+
GWHAAZE00000008	exon	57255495	57255922	+
GWHAAZE00000008	CDS	57255359	57255440	+
GWHAAZE00000008	CDS	57255495	57255922	+

Transcript Sequence
>GWHTAAZE028486 ATGAATGTCCCAGCGAAGGCACGTAGCAAGCGTTCACGCGCTGCCCCATGCAAATGGACTTCCCACCTTTTGGTCCTCTCGCACACCTCGAGCACTGGGAAGAAGACAATCAAGGTTTCACTGAAGAAGAAGGAACCGACTGAGATTTCCGCCAATATAAATAATGGTAGTGATGGCGGGAGGAGGTGCCTCCACTGTGCCACTGATAAGACACCCCAGTGGCGCACGGGGCCCTTGGGCCCAAAAACACTTTGTAATGCTTGTGGGGTCCGGTACAAGTCAGGTCGGCTCGTGCCAGAGTACAGACCTGCTTCGAGCCCGACATTTGTGCTCACTAAACACTCTAATTCGCATAGAAAGGTTCTTGAGCTTCGGAGGCAAAAGGAGCTCCAAGAAGCCTACCAGCATCAACCGCAATTTCTTCACCCGAACATGATGTTCGACTTATTGAATGGTGATGATTACTTGATCCACCAAAATATTGGTCCTGATTATCGGCAATTAATCTAG

Network for GWHGAAZE028452

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00320.28	GATA	63	96	6.00E-16

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2C2-GATA

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0008270	molecular_function	zinc ion binding
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.417
	SRR3591706	second leaf	0.583
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.629
	SRR3591709	Stem	0.862
	SRR3591710	White floral bud	2.684
	SRR3591711	White flower	0.490
	SRR3591712	Green floral bud	5.813
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.460
	SRR8316896	Juvenile bud stage	6.923
	SRR8316897	Juvenile bud stage	2.899
	SRR8316894	Third green stage	2.612
	SRR8316900	Third green stage	6.121
	SRR8316901	Third green stage	8.427
	SRR8316898	Complete white stage	1.037
	SRR8316899	Complete white stage	9.955
	SRR8316903	Complete white stage	2.003
	SRR8316902	Silver flowering stage	0.136
	SRR8316904	Silver flowering stage	0.044
	SRR8316905	Silver flowering stage	0.119
	SRR8316906	Gold flowering stage	0.005
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	3.565
	SRR6706287	Light intensity 50%	1.892
	SRR6706288	Light intensity 20%	1.683
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.979
	CNS0095593	Slightly white alabastrum(diploid) 2	7.696
	CNS0095594	Slightly white alabastrum(diploid) 3	10.443
	CNS0095595	Whole white alabastrum(diploid) 2	6.127
	CNS0095596	Whole white alabastrum(diploid) 3	7.533
	CNS0095597	Whole white alabastrum(diploid) 4	3.607
	CNS0095598	Silvery flower (diploied) 1	0.123
	CNS0095599	Silvery flower (diploied) 2	0.444
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.114
	CNS0095604	Slightly white alabastrum(tetraploid) 1	14.235
	CNS0095605	Slightly white alabastrum(tetraploid) 2	12.278
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.649
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.353
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.719
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.874
	CNS0095610	Silvery flower (diploied) 1	0.613
	CNS0095611	Silvery flower (diploied) 2	0.254
	CNS0095612	Silvery flower (diploied) 3	0.149
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.057
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	2.896
	CRR073298	Stem 2	5.699
	CRR073299	Stem 3	5.926
	CRR073300	Leaf 1	5.163
	CRR073301	Leaf 2	8.365
	CRR073302	Leaf 3	6.972
	CRR073303	Juvenile bud 1	13.527
	CRR073304	Juvenile bud 2	29.202
	CRR073305	Juvenile bud 3	18.754
	CRR073306	Third green 1	0.483
	CRR073307	Third green 2	1.395
	CRR073308	Third green 3	1.037
	CRR073309	Second white 1	0.023
	CRR073310	Second white 2	0.032
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.163
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	3.114
	CRR073319	Tawny withering 2	1.188
	CRR073320	Tawny withering 3	3.887