Gene detail

Detail information of GWHGAAZE028503

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010249578.1	1.62221E-73	PREDICTED: dehydration-responsive element-binding protein 3-like [Nelumbo nucifera]
Swissprot	tr\|Q9LYD3\|DREB3_ARATH	6E-65	Dehydration-responsive element-binding protein 3
trEMBL	tr\|A0A061GK29\|A0A061GK29_THECC	6E-71	Integrase-type DNA-binding superfamily protein {ECO:0000313\|EMBL:EOY29748.1}
TAIR10	AT5G11590.1	2E-47	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	58564665	58565264	-
GWHAAZE00000008	mRNA	58564665	58565264	-
GWHAAZE00000008	exon	58564970	58565264	-
GWHAAZE00000008	exon	58564665	58564936	-
GWHAAZE00000008	CDS	58564970	58565264	-
GWHAAZE00000008	CDS	58564665	58564936	-

Transcript Sequence
>GWHTAAZE028537 ATGAAGAGGATCCGGGAACAGAGCAAGCACCCGGTATACCGGGGGGTCCGGATGAGGAACTGGGGCAAATGGGTATCCGAGATCCGGGAGCCCAGAAAGAAATCCCGGATCTGGCTCGGCACCTTCACCACCCCGGAGATGGCCGCGCGTGCACACGACGTGGCAGCTCTAAGCATAAAAGGCAGCGCTGCCGTCCTGAATTTCCCCGAACTGGCCGGAACCCTGCCCCGGCCGGCTTCCCTCTCCCCCCGCGACGTCCAGGCAGCGGCGGCTCAGGCGGCTGCTATGGACTCCGCTGCTTCTTCTTCCAATTCCTCGGCTTCTTCCGGTGAGTCGTTGATTTCCTCGGCTTTTGACCTTTTGACCTCCGAGGAATTGAGCGAAATCGTCGAGTTGCCGAGTCTCGGGACGAGTTGTGAATCGGCCGAGTTTGTTTTTGCTGACTCAGTGGATGGGTTGTTCTATTCGCCGCCGTGGTTTGACGGCGGCGATAACGGTGGGTACTTTTCCGATGCGGCGGAGAATGTGGTTTGTACTAGTTTTGCGTCTTTGTTGTGGAATTATTAG

Network for GWHGAAZE028503

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	11	61	1.40E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.618
	SRR3591706	second leaf	11.893
	SRR3591707	mature leaf	2.553
	SRR3591708	Shoot apex	9.851
	SRR3591709	Stem	0.368
	SRR3591710	White floral bud	4.206
	SRR3591711	White flower	1.808
	SRR3591712	Green floral bud	7.417
	SRR3591713	Yellow flower	0.408
SRP173429	SRR8316895	Juvenile bud stage	1.364
	SRR8316896	Juvenile bud stage	3.512
	SRR8316897	Juvenile bud stage	0.354
	SRR8316894	Third green stage	1.630
	SRR8316900	Third green stage	8.609
	SRR8316901	Third green stage	6.235
	SRR8316898	Complete white stage	2.142
	SRR8316899	Complete white stage	9.391
	SRR8316903	Complete white stage	2.116
	SRR8316902	Silver flowering stage	0.576
	SRR8316904	Silver flowering stage	1.155
	SRR8316905	Silver flowering stage	0.734
	SRR8316906	Gold flowering stage	0.641
	SRR8316907	Gold flowering stage	0.572
	SRR8316908	Gold flowering stage	0.154
SRP132670	SRR6706286	Control	10.403
	SRR6706287	Light intensity 50%	11.072
	SRR6706288	Light intensity 20%	10.853
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.510
	CNS0095593	Slightly white alabastrum(diploid) 2	4.858
	CNS0095594	Slightly white alabastrum(diploid) 3	2.288
	CNS0095595	Whole white alabastrum(diploid) 2	6.684
	CNS0095596	Whole white alabastrum(diploid) 3	8.232
	CNS0095597	Whole white alabastrum(diploid) 4	5.349
	CNS0095598	Silvery flower (diploied) 1	1.268
	CNS0095599	Silvery flower (diploied) 2	0.003
	CNS0095600	Silvery flower (diploied) 3	2.536
	CNS0095601	Golden flower (diploid) 1	0.364
	CNS0095602	Golden flower (diploid) 2	1.256
	CNS0095603	Golden flower (diploid) 3	1.317
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.351
	CNS0095605	Slightly white alabastrum(tetraploid) 2	8.970
	CNS0095606	Slightly white alabastrum(tetraploid) 3	26.143
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.329
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.263
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.841
	CNS0095610	Silvery flower (diploied) 1	0.295
	CNS0095611	Silvery flower (diploied) 2	0.712
	CNS0095612	Silvery flower (diploied) 3	1.764
	CNS0095613	Golden flower (tetraploid) 1	0.023
	CNS0095614	Golden flower (tetraploid) 2	0.108
	CNS0095615	Golden flower (tetraploid) 3	0.135
CRA001975	CRR073297	Stem 1	18.793
	CRR073298	Stem 2	15.298
	CRR073299	Stem 3	20.602
	CRR073300	Leaf 1	16.526
	CRR073301	Leaf 2	15.229
	CRR073302	Leaf 3	25.206
	CRR073303	Juvenile bud 1	18.369
	CRR073304	Juvenile bud 2	11.867
	CRR073305	Juvenile bud 3	11.143
	CRR073306	Third green 1	12.763
	CRR073307	Third green 2	10.235
	CRR073308	Third green 3	16.722
	CRR073309	Second white 1	1.168
	CRR073310	Second white 2	1.104
	CRR073311	Second white 3	0.311
	CRR073312	Silver flowering 1	0.518
	CRR073313	Silver flowering 2	0.994
	CRR073314	Silver flowering 3	1.057
	CRR073315	Gold flowering 1	1.793
	CRR073316	Gold flowering 2	0.747
	CRR073317	Gold flowering 3	1.488
	CRR073318	Tawny withering 1	0.344
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.374