Gene detail

Detail information of GWHGAAZE029220

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010673819.1	1.09378E-34	PREDICTED: G-type lectin S-receptor-like serine/threonine-protein kinase SD2-5 [Beta vulgaris subsp. vulgaris]
COG	NP_486800.1	2E-13	serine/threonine kinase
Swissprot	tr\|Q39203\|SD22_ARATH	3E-28	G-type lectin S-receptor-like serine/threonine-protein kinase SD2-2 (Precursor)
trEMBL	tr\|V4TVE6\|V4TVE6_9ROSI	4E-31	Uncharacterized protein {ECO:0000313\|EMBL:ESR55670.1}
TAIR10	AT4G00340.1	1E-24	receptor-like protein kinase 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	13437132	13437365	+
GWHAAZE00000009	mRNA	13437132	13437365	+
GWHAAZE00000009	exon	13437132	13437365	+
GWHAAZE00000009	CDS	13437132	13437365	+

Transcript Sequence
>GWHTAAZE029254 GAGTATCTTCACGTCCTCTGCAATCCAAGCATCATTCATTTCGACATAAAACCCCAAAACATACTTCTTGATGAGGATTTCAATGTCAAAATTTCTGATTTTGGGTTAGCTAAGTTGATCGATAGGGACAAAAGCCAAGTGCTAACTGTATTGAAGGGAACTCCAGGATATGTGGCCCCCGAATTGTTTAGTGGCACCAACATCTCGGTCAAGGCTGATGTCTTCAGCTTTGGC

Network for GWHGAAZE029220

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	1	78	6.70E-23

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_SD-2b

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	6.516
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.157
	SRR3591711	White flower	0.354
	SRR3591712	Green floral bud	0.349
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	1.087
	SRR8316896	Juvenile bud stage	0.754
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.473
	SRR8316900	Third green stage	1.130
	SRR8316901	Third green stage	0.933
	SRR8316898	Complete white stage	0.127
	SRR8316899	Complete white stage	1.966
	SRR8316903	Complete white stage	0.219
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.074
	SRR8316905	Silver flowering stage	0.120
	SRR8316906	Gold flowering stage	0.345
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	1.951
	SRR6706287	Light intensity 50%	1.845
	SRR6706288	Light intensity 20%	1.634
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.059
	CNS0095593	Slightly white alabastrum(diploid) 2	3.029
	CNS0095594	Slightly white alabastrum(diploid) 3	0.341
	CNS0095595	Whole white alabastrum(diploid) 2	0.946
	CNS0095596	Whole white alabastrum(diploid) 3	0.289
	CNS0095597	Whole white alabastrum(diploid) 4	1.450
	CNS0095598	Silvery flower (diploied) 1	2.600
	CNS0095599	Silvery flower (diploied) 2	1.484
	CNS0095600	Silvery flower (diploied) 3	0.980
	CNS0095601	Golden flower (diploid) 1	4.592
	CNS0095602	Golden flower (diploid) 2	1.055
	CNS0095603	Golden flower (diploid) 3	1.640
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.469
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.289
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.255
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.519
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.067
	CNS0095610	Silvery flower (diploied) 1	0.081
	CNS0095611	Silvery flower (diploied) 2	0.483
	CNS0095612	Silvery flower (diploied) 3	0.062
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.254
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.207
	CRR073298	Stem 2	0.781
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.729
	CRR073302	Leaf 3	0.552
	CRR073303	Juvenile bud 1	1.416
	CRR073304	Juvenile bud 2	0.287
	CRR073305	Juvenile bud 3	0.082
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.045
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	6.858
	CRR073316	Gold flowering 2	7.016
	CRR073317	Gold flowering 3	2.538
	CRR073318	Tawny withering 1	1.283
	CRR073319	Tawny withering 2	1.233
	CRR073320	Tawny withering 3	0.189