Gene detail

Detail information of GWHGAAZE029353

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008795779.1	2.99975E-20	PREDICTED: phospholipase D p1-like [Phoenix dactylifera]
Swissprot	tr\|Q9M9W8\|PLDP2_ARATH	3E-15	Phospholipase D p2
trEMBL	tr\|W1P8N0\|W1P8N0_AMBTC	2E-18	Uncharacterized protein {ECO:0000313\|EMBL:ERN03345.1}
TAIR10	AT3G05630.1	1E-13	phospholipase D P2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	20115299	20115556	+
GWHAAZE00000009	mRNA	20115299	20115556	+
GWHAAZE00000009	exon	20115299	20115556	+
GWHAAZE00000009	CDS	20115299	20115556	+

Transcript Sequence
>GWHTAAZE029387 ATGTCGTCGGAGCATCTTCTCTCCGGCGGCCATTCGAAGTATTCTCCGATCAAGAAGGAAGCAGAGGCATTGCAGCCGGAGATGACGTCATCGAGCTCGTTCCGGTGCGGTTCCGAGCGAACGGTGATTTTCGATGAATTGCCGAAGGCTACGATAGTATCGGTGTCGAGACCAGATGCTAGTGATTTTAGTCCCTTGCTTCTCTCTTACACAATTGAACTCCAATACAAACAGGCAAATTTCTGTCTCTCTCTCTAA

Network for GWHGAAZE029353

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01115	PLD1_2	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Glycerophospholipid metabolism	map00564
		Ether lipid metabolism	map00565
		Ras signaling pathway	map04014
		Phospholipase D signaling pathway	map04072
		Sphingolipid signaling pathway	map04071
		cAMP signaling pathway	map04024
		Endocytosis	map04144
		Fc gamma R-mediated phagocytosis	map04666
		GnRH signaling pathway	map04912
		Parathyroid hormone synthesis, secretion and action	map04928
		Glutamatergic synapse	map04724

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.391
	SRR3591706	second leaf	0.990
	SRR3591707	mature leaf	7.846
	SRR3591708	Shoot apex	0.752
	SRR3591709	Stem	17.084
	SRR3591710	White floral bud	3.478
	SRR3591711	White flower	4.858
	SRR3591712	Green floral bud	1.298
	SRR3591713	Yellow flower	35.989
SRP173429	SRR8316895	Juvenile bud stage	5.531
	SRR8316896	Juvenile bud stage	8.962
	SRR8316897	Juvenile bud stage	2.339
	SRR8316894	Third green stage	12.230
	SRR8316900	Third green stage	10.939
	SRR8316901	Third green stage	17.845
	SRR8316898	Complete white stage	13.524
	SRR8316899	Complete white stage	19.665
	SRR8316903	Complete white stage	18.474
	SRR8316902	Silver flowering stage	11.438
	SRR8316904	Silver flowering stage	21.887
	SRR8316905	Silver flowering stage	11.071
	SRR8316906	Gold flowering stage	12.364
	SRR8316907	Gold flowering stage	54.076
	SRR8316908	Gold flowering stage	9.795
SRP132670	SRR6706286	Control	19.951
	SRR6706287	Light intensity 50%	24.276
	SRR6706288	Light intensity 20%	18.022
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.511
	CNS0095593	Slightly white alabastrum(diploid) 2	3.399
	CNS0095594	Slightly white alabastrum(diploid) 3	6.254
	CNS0095595	Whole white alabastrum(diploid) 2	2.782
	CNS0095596	Whole white alabastrum(diploid) 3	2.346
	CNS0095597	Whole white alabastrum(diploid) 4	2.147
	CNS0095598	Silvery flower (diploied) 1	11.681
	CNS0095599	Silvery flower (diploied) 2	5.509
	CNS0095600	Silvery flower (diploied) 3	10.907
	CNS0095601	Golden flower (diploid) 1	9.338
	CNS0095602	Golden flower (diploid) 2	22.966
	CNS0095603	Golden flower (diploid) 3	22.797
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.815
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.362
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.207
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.082
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.166
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.277
	CNS0095610	Silvery flower (diploied) 1	15.953
	CNS0095611	Silvery flower (diploied) 2	17.025
	CNS0095612	Silvery flower (diploied) 3	12.380
	CNS0095613	Golden flower (tetraploid) 1	6.776
	CNS0095614	Golden flower (tetraploid) 2	7.796
	CNS0095615	Golden flower (tetraploid) 3	14.181
CRA001975	CRR073297	Stem 1	5.229
	CRR073298	Stem 2	7.053
	CRR073299	Stem 3	4.792
	CRR073300	Leaf 1	11.456
	CRR073301	Leaf 2	15.957
	CRR073302	Leaf 3	4.277
	CRR073303	Juvenile bud 1	5.274
	CRR073304	Juvenile bud 2	4.202
	CRR073305	Juvenile bud 3	8.084
	CRR073306	Third green 1	4.699
	CRR073307	Third green 2	3.234
	CRR073308	Third green 3	6.528
	CRR073309	Second white 1	7.238
	CRR073310	Second white 2	7.876
	CRR073311	Second white 3	13.280
	CRR073312	Silver flowering 1	13.735
	CRR073313	Silver flowering 2	13.931
	CRR073314	Silver flowering 3	14.542
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	2.964
	CRR073317	Gold flowering 3	0.850
	CRR073318	Tawny withering 1	14.085
	CRR073319	Tawny withering 2	6.892
	CRR073320	Tawny withering 3	5.637