Gene detail

Detail information of GWHGAAZE029499

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009416032.1	4.17094E-49	PREDICTED: probable leucine-rich repeat receptor-like protein kinase At5g49770 [Musa acuminata subsp. malaccensis]
Swissprot	tr\|Q9LT96\|Y5977_ARATH	5E-32	Probable leucine-rich repeat receptor-like protein kinase At5g49770 (Precursor)
trEMBL	tr\|A0A061G9V7\|A0A061G9V7_THECC	4E-46	Leucine-rich repeat protein kinase family protein, putative isoform 2 {ECO:0000313\|EMBL:EOY26366.1}
TAIR10	AT5G49760.1	3E-31	Leucine-rich repeat protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	24323208	24323666	+
GWHAAZE00000009	mRNA	24323208	24323666	+
GWHAAZE00000009	exon	24323208	24323666	+
GWHAAZE00000009	CDS	24323208	24323666	+

Transcript Sequence
>GWHTAAZE029533 ATGGATCCCGAGTACTACATGACCCAACAATTAACCGACAAGAGTGACGTCTATAGCTTTGGAGTCGTACTCTTGGAGCTCGTAACTGCCAGAGCCCCAATATATCAAGGCAAGTACATTGTGAGAGAAGTAAGGGAAGCAATGGACAACTCGAAACTCCATGATATTCTTGACCCAAAACTAGGTTTGGGCCCAAGTCTTGGAGGTTTGGATAGGTTTCTGAACCTTGCAATGAGCTGCGTTAAAGACTCGGGGGCCGAGAGGCCTGCAATGGGAGAGGTGGTTAAAGAGATCGAGAGTATTATACAGTTGGCTCTGCCGAATGCAAATACTGATTCAGTATCGAATTTGTCGAGTAATGATGGGACAAGTGAGAGGAACCTTTACGAGCCTTTTGGTGATGAGTCCGGCTATGATTATAGCGGCGTCTCTGTGCCCTTTCAGACCGAGCTCCGGTGA

Network for GWHGAAZE029499

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	1	97	5.20E-08

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-VIII-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.182
	SRR3591706	second leaf	2.498
	SRR3591707	mature leaf	3.523
	SRR3591708	Shoot apex	5.207
	SRR3591709	Stem	3.822
	SRR3591710	White floral bud	2.882
	SRR3591711	White flower	5.098
	SRR3591712	Green floral bud	3.954
	SRR3591713	Yellow flower	4.675
SRP173429	SRR8316895	Juvenile bud stage	1.307
	SRR8316896	Juvenile bud stage	2.066
	SRR8316897	Juvenile bud stage	0.845
	SRR8316894	Third green stage	0.836
	SRR8316900	Third green stage	1.270
	SRR8316901	Third green stage	1.947
	SRR8316898	Complete white stage	0.209
	SRR8316899	Complete white stage	2.447
	SRR8316903	Complete white stage	0.844
	SRR8316902	Silver flowering stage	0.952
	SRR8316904	Silver flowering stage	2.024
	SRR8316905	Silver flowering stage	0.248
	SRR8316906	Gold flowering stage	3.111
	SRR8316907	Gold flowering stage	2.880
	SRR8316908	Gold flowering stage	2.673
SRP132670	SRR6706286	Control	1.300
	SRR6706287	Light intensity 50%	1.239
	SRR6706288	Light intensity 20%	1.394
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.336
	CNS0095593	Slightly white alabastrum(diploid) 2	2.563
	CNS0095594	Slightly white alabastrum(diploid) 3	0.946
	CNS0095595	Whole white alabastrum(diploid) 2	0.177
	CNS0095596	Whole white alabastrum(diploid) 3	1.498
	CNS0095597	Whole white alabastrum(diploid) 4	1.748
	CNS0095598	Silvery flower (diploied) 1	1.674
	CNS0095599	Silvery flower (diploied) 2	1.827
	CNS0095600	Silvery flower (diploied) 3	1.384
	CNS0095601	Golden flower (diploid) 1	1.116
	CNS0095602	Golden flower (diploid) 2	0.869
	CNS0095603	Golden flower (diploid) 3	1.177
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.827
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.465
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.011
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.292
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.628
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.287
	CNS0095610	Silvery flower (diploied) 1	1.183
	CNS0095611	Silvery flower (diploied) 2	1.170
	CNS0095612	Silvery flower (diploied) 3	2.588
	CNS0095613	Golden flower (tetraploid) 1	3.358
	CNS0095614	Golden flower (tetraploid) 2	0.913
	CNS0095615	Golden flower (tetraploid) 3	0.867
CRA001975	CRR073297	Stem 1	2.237
	CRR073298	Stem 2	1.359
	CRR073299	Stem 3	0.278
	CRR073300	Leaf 1	1.196
	CRR073301	Leaf 2	0.620
	CRR073302	Leaf 3	1.230
	CRR073303	Juvenile bud 1	0.064
	CRR073304	Juvenile bud 2	0.590
	CRR073305	Juvenile bud 3	0.197
	CRR073306	Third green 1	0.154
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	1.609
	CRR073311	Second white 3	0.607
	CRR073312	Silver flowering 1	0.255
	CRR073313	Silver flowering 2	0.133
	CRR073314	Silver flowering 3	0.722
	CRR073315	Gold flowering 1	0.048
	CRR073316	Gold flowering 2	2.538
	CRR073317	Gold flowering 3	1.295
	CRR073318	Tawny withering 1	0.845
	CRR073319	Tawny withering 2	5.690
	CRR073320	Tawny withering 3	4.039