Gene detail

Detail information of GWHGAAZE029583

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU35020.1	1.33821E-56	hypothetical protein MIMGU_mgv1a019444mg [Erythranthe guttata]
COG	YP_003650685.1	8E-17	PASTA sensor domain-containing serine/threonine protein kinase
Swissprot	tr\|Q40541\|NPK1_TOBAC	3E-37	Mitogen-activated protein kinase kinase kinase NPK1
trEMBL	tr\|A0A022R812\|A0A022R812_ERYGU	5E-57	Uncharacterized protein {ECO:0000313\|EMBL:EYU35020.1}
TAIR10	AT3G06030.1	9E-32	NPK1-related protein kinase 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	28960446	28960847	+
GWHAAZE00000009	mRNA	28960446	28960847	+
GWHAAZE00000009	exon	28960446	28960847	+
GWHAAZE00000009	CDS	28960446	28960847	+

Transcript Sequence
>GWHTAAZE029617 ATGGCTGGTGGTAGTCTTGCTGATGTGGCAGAGAAATTTGGGGGCACGCTTGACGAGAGAGTGATTAGATTGTACACTCGCGAGATTCTTTTGGGCTTGAATTATTTACACAAGAATGGAATCGTACACTCAGATCTCAAATGCAAGAATGTGCTTTTGGGTACATTTGGGGATGTAAAATTGGCTGATTTTGGATGTGCGAAGAGGGTAAAGGAGACTAATTCAATTAAATCTTGTACCTCCTTTGGTGGGACCCCATTGTGGATGGCCCCCGAGGTTTTGAGGAACGAACGGTTGGATTTCTCTGCTGATATTTGGTCGTTAGGGTGCACAATTATCGAGATGGCCACGGAAAAACGCCTTGGGGTGACAAAATTTCAAACCCAATGGCGGCCGTGTTGA

Network for GWHGAAZE029583

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	1	121	8.10E-36

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	STE_STE11

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.104
	SRR3591709	Stem	1.057
	SRR3591710	White floral bud	80.310
	SRR3591711	White flower	3.332
	SRR3591712	Green floral bud	75.262
	SRR3591713	Yellow flower	4.684
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	2.687
	SRR8316897	Juvenile bud stage	2.167
	SRR8316894	Third green stage	2.117
	SRR8316900	Third green stage	24.593
	SRR8316901	Third green stage	24.295
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.166
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.328
	SRR8316904	Silver flowering stage	1.420
	SRR8316905	Silver flowering stage	0.476
	SRR8316906	Gold flowering stage	0.082
	SRR8316907	Gold flowering stage	0.508
	SRR8316908	Gold flowering stage	0.258
SRP132670	SRR6706286	Control	20.034
	SRR6706287	Light intensity 50%	16.276
	SRR6706288	Light intensity 20%	15.669
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	20.849
	CNS0095593	Slightly white alabastrum(diploid) 2	18.374
	CNS0095594	Slightly white alabastrum(diploid) 3	22.870
	CNS0095595	Whole white alabastrum(diploid) 2	76.405
	CNS0095596	Whole white alabastrum(diploid) 3	82.875
	CNS0095597	Whole white alabastrum(diploid) 4	103.582
	CNS0095598	Silvery flower (diploied) 1	2.394
	CNS0095599	Silvery flower (diploied) 2	5.850
	CNS0095600	Silvery flower (diploied) 3	2.917
	CNS0095601	Golden flower (diploid) 1	1.846
	CNS0095602	Golden flower (diploid) 2	1.590
	CNS0095603	Golden flower (diploid) 3	1.864
	CNS0095604	Slightly white alabastrum(tetraploid) 1	49.398
	CNS0095605	Slightly white alabastrum(tetraploid) 2	53.060
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.104
	CNS0095607	Whole white alabastrum(tetraploid) 1	117.967
	CNS0095608	Whole white alabastrum(tetraploid) 2	144.505
	CNS0095609	Whole white alabastrum(tetraploid) 3	68.937
	CNS0095610	Silvery flower (diploied) 1	0.983
	CNS0095611	Silvery flower (diploied) 2	3.362
	CNS0095612	Silvery flower (diploied) 3	11.509
	CNS0095613	Golden flower (tetraploid) 1	1.790
	CNS0095614	Golden flower (tetraploid) 2	0.600
	CNS0095615	Golden flower (tetraploid) 3	7.462
CRA001975	CRR073297	Stem 1	3.325
	CRR073298	Stem 2	4.808
	CRR073299	Stem 3	1.961
	CRR073300	Leaf 1	35.709
	CRR073301	Leaf 2	16.952
	CRR073302	Leaf 3	10.504
	CRR073303	Juvenile bud 1	30.287
	CRR073304	Juvenile bud 2	15.792
	CRR073305	Juvenile bud 3	1.720
	CRR073306	Third green 1	8.688
	CRR073307	Third green 2	4.841
	CRR073308	Third green 3	9.608
	CRR073309	Second white 1	1.774
	CRR073310	Second white 2	4.936
	CRR073311	Second white 3	3.103
	CRR073312	Silver flowering 1	10.199
	CRR073313	Silver flowering 2	10.364
	CRR073314	Silver flowering 3	4.130
	CRR073315	Gold flowering 1	7.981
	CRR073316	Gold flowering 2	1.307
	CRR073317	Gold flowering 3	0.655
	CRR073318	Tawny withering 1	7.727
	CRR073319	Tawny withering 2	9.753
	CRR073320	Tawny withering 3	6.737