Gene detail

Detail information of GWHGAAZE029834

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP01001.1	3.6377E-29	unnamed protein product [Coffea canephora]
COG	YP_004346032.1	3E-11	Squalene monooxygenase
Swissprot	tr\|O81000\|ERG15_ARATH	4E-29	Squalene epoxidase 2, mitochondrial (Precursor)
trEMBL	tr\|A0A068TXL6\|A0A068TXL6_COFCA	1E-29	Coffea canephora DH200=94 genomic scaffold, scaffold_6 {ECO:0000313\|EMBL:CDP01001.1}
TAIR10	AT2G22830.1	2E-25	squalene epoxidase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	34059307	34060844	+
GWHAAZE00000009	mRNA	34059307	34060844	+
GWHAAZE00000009	exon	34059307	34059524	+
GWHAAZE00000009	exon	34060739	34060844	+
GWHAAZE00000009	CDS	34059307	34059524	+
GWHAAZE00000009	CDS	34060739	34060844	+

Transcript Sequence
>GWHTAAZE029868 ATGAGACATCCTTTAACTGGAAGAGGAATGACAGTTGCTTTATTTGACATCGTTGTGCTTCGAGACATTCTTACACCATTTGCCAATTTCAATGATCCTACTACACTCTACCAACATCTTGTGTCTTTTTACACTTTTAAGTATGTTATAAGTTGTAAATAATGTATTAGGAAGGTAGATAATTTAGGAATCCTAATTAGCAGTTGTTTCCTTATTTGGAATGAATTGGGGCAAGCGTGTTTTGATTATTTGAGCCTTGGTGGTAATTTTTCAAATGGACCCGTTGCTCTACTTTCTGGTCTTAACCCCCTAAGCTATCATTGA

Network for GWHGAAZE029834

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08491.11	SE	1	103	2.00E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00511	SQLE, ERG1	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Steroid biosynthesis	map00100
		Sesquiterpenoid and triterpenoid biosynthesis	map00909

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016021	cellular_component	integral component of membrane
GO:0004506	molecular_function	squalene monooxygenase activity
GO:0050660	molecular_function	flavin adenine dinucleotide binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.327
	SRR3591706	second leaf	0.356
	SRR3591707	mature leaf	0.358
	SRR3591708	Shoot apex	1.308
	SRR3591709	Stem	0.136
	SRR3591710	White floral bud	0.682
	SRR3591711	White flower	0.187
	SRR3591712	Green floral bud	0.139
	SRR3591713	Yellow flower	0.200
SRP173429	SRR8316895	Juvenile bud stage	0.068
	SRR8316896	Juvenile bud stage	1.618
	SRR8316897	Juvenile bud stage	0.278
	SRR8316894	Third green stage	0.021
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.053
	SRR8316898	Complete white stage	0.088
	SRR8316899	Complete white stage	0.171
	SRR8316903	Complete white stage	0.314
	SRR8316902	Silver flowering stage	0.245
	SRR8316904	Silver flowering stage	0.606
	SRR8316905	Silver flowering stage	0.076
	SRR8316906	Gold flowering stage	0.076
	SRR8316907	Gold flowering stage	0.082
	SRR8316908	Gold flowering stage	0.102
SRP132670	SRR6706286	Control	0.048
	SRR6706287	Light intensity 50%	0.089
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.364
	CNS0095593	Slightly white alabastrum(diploid) 2	0.410
	CNS0095594	Slightly white alabastrum(diploid) 3	0.380
	CNS0095595	Whole white alabastrum(diploid) 2	0.209
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.087
	CNS0095598	Silvery flower (diploied) 1	1.298
	CNS0095599	Silvery flower (diploied) 2	0.507
	CNS0095600	Silvery flower (diploied) 3	1.064
	CNS0095601	Golden flower (diploid) 1	0.633
	CNS0095602	Golden flower (diploid) 2	1.180
	CNS0095603	Golden flower (diploid) 3	0.184
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.231
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.094
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.162
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.095
	CNS0095610	Silvery flower (diploied) 1	0.251
	CNS0095611	Silvery flower (diploied) 2	0.060
	CNS0095612	Silvery flower (diploied) 3	0.263
	CNS0095613	Golden flower (tetraploid) 1	0.653
	CNS0095614	Golden flower (tetraploid) 2	0.129
	CNS0095615	Golden flower (tetraploid) 3	0.252
CRA001975	CRR073297	Stem 1	0.037
	CRR073298	Stem 2	0.041
	CRR073299	Stem 3	0.072
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.050
	CRR073302	Leaf 3	0.137
	CRR073303	Juvenile bud 1	0.080
	CRR073304	Juvenile bud 2	0.011
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.333
	CRR073307	Third green 2	0.103
	CRR073308	Third green 3	0.304
	CRR073309	Second white 1	0.091
	CRR073310	Second white 2	0.258
	CRR073311	Second white 3	0.097
	CRR073312	Silver flowering 1	0.373
	CRR073313	Silver flowering 2	0.165
	CRR073314	Silver flowering 3	0.144
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000