Gene detail

Detail information of GWHGAAZE029951

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009613764.1	5.61306E-47	PREDICTED: ethylene-responsive transcription factor ERF109-like [Nicotiana tomentosiformis]
Swissprot	tr\|Q9SZ06\|EF109_ARATH	9E-33	Ethylene-responsive transcription factor ERF109
trEMBL	tr\|A0A097LG53\|A0A097LG53_9ROSA	5E-45	EREBP-like factor {ECO:0000313\|EMBL:AIU05286.1}
TAIR10	AT4G34410.1	3E-26	redox responsive transcription factor 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	35805449	35805916	+
GWHAAZE00000009	mRNA	35805449	35805916	+
GWHAAZE00000009	exon	35805449	35805916	+
GWHAAZE00000009	CDS	35805449	35805916	+

Transcript Sequence
>GWHTAAZE029985 ATGGTCGCGGCCCTGAAAACCGTCATTAATGGATGCGCCACCTCAGCTCCCCAATTCCAAGAATGCACCACTGATACATCTCCGCCGTTTGAACTGGTGACGATATTGGAGCCTGACACATGTAAAATTTGCGGAATTGAAGGCTGCTTAGGCTGCGATTTTTTCGAGGATAAAATGAATAACAGCGCCGTCACCAAAAAAAAGAAGAGTAATTACAGAGGGGTGAGGCAAAGGCCGTGGGGGAAATGGGCGGCCGAGATTCGGGACCCGAGAAAAGCGGTTCGGGTCTGGCTCGGGACCTTCCTGACAGCTGAAGCCGCGGCTCGGGCTTATGACCGAGCCGCCATTGAGTTTAGAGGATCGAGAGCGAAGCTCAATTTTGGGTTTTCGGATTATACATTGCCGGTTAATGAGCCGAGTTCGGAGAAATTAGAGAAGGAAAATTCGAGGAAGAGGGGAATGGAATAG

Network for GWHGAAZE029951

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0181	Transcription factor AP2/ERF-ERF family Transcription factor AP2/ERF-ERF GO:0003993 acid phosphatase activity GOslim:molecular_function

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	70	120	1.20E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.334
	SRR3591706	second leaf	0.167
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.422
	SRR3591709	Stem	4.595
	SRR3591710	White floral bud	1.250
	SRR3591711	White flower	6.855
	SRR3591712	Green floral bud	0.039
	SRR3591713	Yellow flower	3.656
SRP173429	SRR8316895	Juvenile bud stage	67.705
	SRR8316896	Juvenile bud stage	58.942
	SRR8316897	Juvenile bud stage	48.346
	SRR8316894	Third green stage	1.327
	SRR8316900	Third green stage	3.924
	SRR8316901	Third green stage	26.915
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	17.038
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.305
	SRR8316904	Silver flowering stage	0.069
	SRR8316905	Silver flowering stage	0.268
	SRR8316906	Gold flowering stage	1.301
	SRR8316907	Gold flowering stage	2.138
	SRR8316908	Gold flowering stage	0.357
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.070
	CNS0095593	Slightly white alabastrum(diploid) 2	15.316
	CNS0095594	Slightly white alabastrum(diploid) 3	11.274
	CNS0095595	Whole white alabastrum(diploid) 2	11.951
	CNS0095596	Whole white alabastrum(diploid) 3	0.468
	CNS0095597	Whole white alabastrum(diploid) 4	8.939
	CNS0095598	Silvery flower (diploied) 1	51.270
	CNS0095599	Silvery flower (diploied) 2	110.186
	CNS0095600	Silvery flower (diploied) 3	21.718
	CNS0095601	Golden flower (diploid) 1	47.380
	CNS0095602	Golden flower (diploid) 2	33.318
	CNS0095603	Golden flower (diploid) 3	30.888
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.001
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.001
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (diploied) 1	0.065
	CNS0095611	Silvery flower (diploied) 2	0.000
	CNS0095612	Silvery flower (diploied) 3	0.651
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.001
CRA001975	CRR073297	Stem 1	0.614
	CRR073298	Stem 2	1.873
	CRR073299	Stem 3	0.103
	CRR073300	Leaf 1	1.415
	CRR073301	Leaf 2	8.890
	CRR073302	Leaf 3	0.104
	CRR073303	Juvenile bud 1	1.358
	CRR073304	Juvenile bud 2	8.345
	CRR073305	Juvenile bud 3	6.011
	CRR073306	Third green 1	3.849
	CRR073307	Third green 2	7.075
	CRR073308	Third green 3	1.058
	CRR073309	Second white 1	6.126
	CRR073310	Second white 2	3.597
	CRR073311	Second white 3	1.003
	CRR073312	Silver flowering 1	12.277
	CRR073313	Silver flowering 2	6.950
	CRR073314	Silver flowering 3	3.601
	CRR073315	Gold flowering 1	0.647
	CRR073316	Gold flowering 2	4.770
	CRR073317	Gold flowering 3	6.564
	CRR073318	Tawny withering 1	1.215
	CRR073319	Tawny withering 2	34.810
	CRR073320	Tawny withering 3	2.807