Gene detail

Detail information of GWHGAAZE030966

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006399666.1	2.4933E-50	hypothetical protein EUTSA_v10015895mg [Eutrema salsugineum]
Swissprot	tr\|Q9LYD3\|DREB3_ARATH	2E-52	Dehydration-responsive element-binding protein 3
trEMBL	tr\|V4LBR6\|V4LBR6_EUTSA	9E-51	Uncharacterized protein {ECO:0000313\|EMBL:ESQ41119.1}
TAIR10	AT5G11590.1	5E-38	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	51074210	51074605	+
GWHAAZE00000009	mRNA	51074210	51074605	+
GWHAAZE00000009	exon	51074210	51074605	+
GWHAAZE00000009	CDS	51074210	51074605	+

Transcript Sequence
>GWHTAAZE031000 ATGGCTGAAACCAGTACTACAAATCCCCTTTCATCTTCATCAGAGTCGATTCACTCGTCCAACAAACCCAAATCCCAAAATCCAGAAGAGAAAAAAGTACGTAGCAAGAAGAGAGCAAGAGATAGCGGAAACAAACACCCAATTTACAGAGGAGTACGTAAGAGGAGTTGGGGCAAATGGGTTTCCGAAATTCGCCAACCTCGAAAGAAATCCCGAATTTGGCTCGGTACTTACCCTACTCCTGAAATGGCCGCTAGAGCTCACGACGTCGCCGCTTTAAGCATCAAAGGTAACTCCGCCATTCTCAATTTTCCCCAACTCACTCGGTTCTTCCCCAGTCCGGCATCACTTTCGCCTCAGGATATTCAAGCTGCCGCGGCTAAAGCGGCCGCAATG

Network for GWHGAAZE030966

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	47	97	5.00E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	18.293
	SRR3591706	second leaf	8.046
	SRR3591707	mature leaf	1.585
	SRR3591708	Shoot apex	9.537
	SRR3591709	Stem	5.033
	SRR3591710	White floral bud	25.002
	SRR3591711	White flower	14.881
	SRR3591712	Green floral bud	16.166
	SRR3591713	Yellow flower	1.446
SRP173429	SRR8316895	Juvenile bud stage	3.547
	SRR8316896	Juvenile bud stage	3.415
	SRR8316897	Juvenile bud stage	2.189
	SRR8316894	Third green stage	1.805
	SRR8316900	Third green stage	10.070
	SRR8316901	Third green stage	11.574
	SRR8316898	Complete white stage	4.241
	SRR8316899	Complete white stage	16.926
	SRR8316903	Complete white stage	6.646
	SRR8316902	Silver flowering stage	3.609
	SRR8316904	Silver flowering stage	4.387
	SRR8316905	Silver flowering stage	2.029
	SRR8316906	Gold flowering stage	1.627
	SRR8316907	Gold flowering stage	4.069
	SRR8316908	Gold flowering stage	3.002
SRP132670	SRR6706286	Control	6.608
	SRR6706287	Light intensity 50%	9.676
	SRR6706288	Light intensity 20%	13.698
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.639
	CNS0095593	Slightly white alabastrum(diploid) 2	6.754
	CNS0095594	Slightly white alabastrum(diploid) 3	2.564
	CNS0095595	Whole white alabastrum(diploid) 2	6.261
	CNS0095596	Whole white alabastrum(diploid) 3	2.303
	CNS0095597	Whole white alabastrum(diploid) 4	9.289
	CNS0095598	Silvery flower (diploied) 1	6.408
	CNS0095599	Silvery flower (diploied) 2	6.616
	CNS0095600	Silvery flower (diploied) 3	3.383
	CNS0095601	Golden flower (diploid) 1	3.570
	CNS0095602	Golden flower (diploid) 2	3.191
	CNS0095603	Golden flower (diploid) 3	3.472
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.044
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.831
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.243
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.176
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.453
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.334
	CNS0095610	Silvery flower (diploied) 1	3.397
	CNS0095611	Silvery flower (diploied) 2	3.334
	CNS0095612	Silvery flower (diploied) 3	3.389
	CNS0095613	Golden flower (tetraploid) 1	0.645
	CNS0095614	Golden flower (tetraploid) 2	1.059
	CNS0095615	Golden flower (tetraploid) 3	1.023
CRA001975	CRR073297	Stem 1	1.826
	CRR073298	Stem 2	3.033
	CRR073299	Stem 3	1.814
	CRR073300	Leaf 1	5.480
	CRR073301	Leaf 2	5.779
	CRR073302	Leaf 3	4.484
	CRR073303	Juvenile bud 1	4.623
	CRR073304	Juvenile bud 2	5.515
	CRR073305	Juvenile bud 3	7.125
	CRR073306	Third green 1	21.139
	CRR073307	Third green 2	40.216
	CRR073308	Third green 3	40.078
	CRR073309	Second white 1	10.058
	CRR073310	Second white 2	7.514
	CRR073311	Second white 3	4.611
	CRR073312	Silver flowering 1	2.699
	CRR073313	Silver flowering 2	1.594
	CRR073314	Silver flowering 3	2.523
	CRR073315	Gold flowering 1	1.719
	CRR073316	Gold flowering 2	0.920
	CRR073317	Gold flowering 3	1.171
	CRR073318	Tawny withering 1	18.091
	CRR073319	Tawny withering 2	21.939
	CRR073320	Tawny withering 3	6.702