Gene detail

Detail information of GWHGAAZE031416

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010046707.1	2.37869E-39	PREDICTED: syntaxin-71-like [Eucalyptus grandis]
Swissprot	tr\|Q9SF29\|SYP71_ARATH	4E-38	Syntaxin-71
trEMBL	tr\|A0A059DE16\|A0A059DE16_EUCGR	9E-40	Uncharacterized protein {ECO:0000313\|EMBL:KCW88822.1}
TAIR10	AT3G09740.1	5E-21	syntaxin of plants 71

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	58601301	58603253	+
GWHAAZE00000009	mRNA	58601301	58603253	+
GWHAAZE00000009	exon	58601301	58601321	+
GWHAAZE00000009	exon	58601734	58601802	+
GWHAAZE00000009	exon	58601965	58602114	+
GWHAAZE00000009	exon	58603018	58603080	+
GWHAAZE00000009	exon	58603173	58603253	+
GWHAAZE00000009	CDS	58601301	58601321	+
GWHAAZE00000009	CDS	58601734	58601802	+
GWHAAZE00000009	CDS	58601965	58602114	+
GWHAAZE00000009	CDS	58603018	58603080	+
GWHAAZE00000009	CDS	58603173	58603253	+

Transcript Sequence
>GWHTAAZE031452 ATGGACGAAAGCATCTCTATGGATGAAGGGTTGGACGTCATAGCAGAAGGGCTGGATACCTTAAAAAACATGGCCCACGACATCAATGAGGAATTGGATCGGCAGGTGCCACTGATGGATGAGATTGATGACAAGGCAATTATTTCTCCATTTACAATATGCATTCTTTTGTCCTTCATATTTTTCAGGGAACTTGGCAGTTGTTTAGAGCAAAAGTGCAATGATTTTTCCCTCGGGCAAGTTGATAGGGCAAACTCCGAACTCAAAAATACAAATGTGAAACTCAAGGACACAATTACACAGCTGAGATCTAGTCGCAATTTCTGCATCGATATCATCCTGTTATGTTTAATTCTAGGAATTGCTGCGTATTTATACAAGTAA

Network for GWHGAAZE031416

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05739.20	SNARE	81	122	5.90E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08506	SYP7	SNARE interactions in vesicular transport	map04130

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.424
	SRR3591707	mature leaf	0.707
	SRR3591708	Shoot apex	0.108
	SRR3591709	Stem	0.214
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.931
	SRR3591713	Yellow flower	0.271
SRP173429	SRR8316895	Juvenile bud stage	2.925
	SRR8316896	Juvenile bud stage	3.038
	SRR8316897	Juvenile bud stage	0.286
	SRR8316894	Third green stage	0.136
	SRR8316900	Third green stage	0.530
	SRR8316901	Third green stage	0.118
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.072
	SRR8316903	Complete white stage	0.132
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.015
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.046
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.077
	SRR6706287	Light intensity 50%	0.059
	SRR6706288	Light intensity 20%	0.242
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.442
	CNS0095593	Slightly white alabastrum(diploid) 2	0.543
	CNS0095594	Slightly white alabastrum(diploid) 3	2.491
	CNS0095595	Whole white alabastrum(diploid) 2	0.181
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.100
	CNS0095598	Silvery flower (diploied) 1	0.040
	CNS0095599	Silvery flower (diploied) 2	0.583
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.089
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.304
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.258
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.726
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.077
	CNS0095610	Silvery flower (diploied) 1	0.000
	CNS0095611	Silvery flower (diploied) 2	0.000
	CNS0095612	Silvery flower (diploied) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.676
	CRR073298	Stem 2	0.171
	CRR073299	Stem 3	1.584
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.203
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.151
	CRR073316	Gold flowering 2	0.933
	CRR073317	Gold flowering 3	0.429
	CRR073318	Tawny withering 1	0.010
	CRR073319	Tawny withering 2	0.238
	CRR073320	Tawny withering 3	0.000