Gene detail

Detail information of GWHGAAZE032065

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AID51418.1	2.8176E-48	ethylene response factor 13 [Diospyros kaki]
Swissprot	tr\|O80542\|ERF19_ARATH	3E-38	Ethylene-responsive transcription factor ERF019
trEMBL	tr\|A0A068ER16\|A0A068ER16_DIOKA	1E-48	Ethylene response factor 13 {ECO:0000313\|EMBL:AID51418.1}
TAIR10	AT1G22810.1	6E-24	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	70005255	70005674	+
GWHAAZE00000009	mRNA	70005255	70005674	+
GWHAAZE00000009	exon	70005255	70005674	+
GWHAAZE00000009	CDS	70005255	70005674	+

Transcript Sequence
>GWHTAAZE032103 ATGACATTACCCCAAGAGAAGAAATACAGGGGAGTTCGAATCCGCAAATGGGGCAAATGGGTATCAGAGATCCGAGTGCCCGGAACCCCAACCAGACTCTGGCTCGGATCCTACGCCACTCCCGAGGCTGCCGCCACTGCCTACGATATAGCCTCCTACTGTTTACGAGGTTCTGAGATTCTTGGAAAGCTTAATTTTGAGCTTGTTTTGCCCGCGAGTGTCCGGCCGGAGATGTCCCCGAGGTCTATACAGAAGGTGGCAGTGGATGCCGGAATGGCGGTGGATGCGGGCTTGGTGGTGAACCGTCCGGCCGGCAGTAACTTGAAGGGGGAGGGAGAGGGTGACTCTGTTCTGTCGAGAGGGAGCGGGGTGAATGAACAAGGGGAGGCTTTGAGCATTTCTGTTGATGATTATCTCTAA

Network for GWHGAAZE032065

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	8	57	4.40E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.599
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.178
	SRR8316896	Juvenile bud stage	0.238
	SRR8316897	Juvenile bud stage	0.462
	SRR8316894	Third green stage	0.403
	SRR8316900	Third green stage	0.193
	SRR8316901	Third green stage	0.389
	SRR8316898	Complete white stage	0.088
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.197
	SRR8316902	Silver flowering stage	0.905
	SRR8316904	Silver flowering stage	0.220
	SRR8316905	Silver flowering stage	0.610
	SRR8316906	Gold flowering stage	2.465
	SRR8316907	Gold flowering stage	3.659
	SRR8316908	Gold flowering stage	4.032
SRP132670	SRR6706286	Control	0.355
	SRR6706287	Light intensity 50%	0.904
	SRR6706288	Light intensity 20%	0.634
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.506
	CNS0095593	Slightly white alabastrum(diploid) 2	2.327
	CNS0095594	Slightly white alabastrum(diploid) 3	3.569
	CNS0095595	Whole white alabastrum(diploid) 2	1.126
	CNS0095596	Whole white alabastrum(diploid) 3	0.177
	CNS0095597	Whole white alabastrum(diploid) 4	0.211
	CNS0095598	Silvery flower (diploied) 1	0.768
	CNS0095599	Silvery flower (diploied) 2	0.283
	CNS0095600	Silvery flower (diploied) 3	0.317
	CNS0095601	Golden flower (diploid) 1	2.662
	CNS0095602	Golden flower (diploid) 2	1.036
	CNS0095603	Golden flower (diploid) 3	1.085
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.012
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.138
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (diploied) 1	0.186
	CNS0095611	Silvery flower (diploied) 2	0.000
	CNS0095612	Silvery flower (diploied) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.170
	CNS0095614	Golden flower (tetraploid) 2	0.200
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.399
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.145
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.591
	CRR073306	Third green 1	0.119
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.094
	CRR073313	Silver flowering 2	0.127
	CRR073314	Silver flowering 3	0.088
	CRR073315	Gold flowering 1	0.301
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.139
	CRR073318	Tawny withering 1	0.300
	CRR073319	Tawny withering 2	3.047
	CRR073320	Tawny withering 3	0.000