Gene detail

Detail information of GWHGAAZE032576

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP14140.1	3.00882E-72	unnamed protein product [Coffea canephora]
COG	YP_007421411.1	6E-10	Glycosyltransferase, MGT
Swissprot	tr\|Q9ZSK5\|ZOG_PHALU	1E-69	Zeatin O-glucosyltransferase
trEMBL	tr\|A0A068V026\|A0A068V026_COFCA	1E-72	Coffea canephora DH200=94 genomic scaffold, scaffold_80 {ECO:0000313\|EMBL:CDP14140.1}
TAIR10	AT4G34138.1	2E-34	UDP-glucosyl transferase 73B1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000021	gene	4828315	4828758	+
GWHAAZE00000021	mRNA	4828315	4828758	+
GWHAAZE00000021	exon	4828315	4828758	+
GWHAAZE00000021	CDS	4828315	4828758	+

Transcript Sequence
>GWHTAAZE032614 ATGGCAAATTTACCAAAAGGCTACGAAGAGAGAATTGAAGGGAGAGGAATAGTGGTGAGAGATTGGGCCCCACAATTGGAGATACTAGCGCACTCTGGTACGGGAGGGTTCATGAGTCACTGTGGTTGGAACTCGTGTATGGAAAGTATCACATATGGTGTGCCAATGGCAACCTGGCCCATGCACTCTGACCAGCCCTATAACGCGGTTTTGATAACAAAAGTACTGAGAACGGGTGTTGCAGTTAAAGATTGGAAATGTAGAAACGAAATGGTGACAGCTTTGATGGTGGAAAGAGGTGTGAGGAGGTTGATGGTGGACAGAGAAGGGGAAGAATTGGGGAAGAGAGCGGCGGAGTTAGGCGTTGCAGTCAAAAGGGCGGTGGCAGAGGGTGGCATTAGTAGGGTGGAGTTGGATTCTTTTGTTGCTCGCATCACTAGATAA

Network for GWHGAAZE032576

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00201.19	UDPGT	18	76	4.00E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13495	CISZOG	Zeatin biosynthesis	map00908

Gene Ontology

GO term	Ontology	Name
GO:0016758	molecular_function	transferase activity, transferring hexosyl groups

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.913
	SRR3591706	second leaf	2.228
	SRR3591707	mature leaf	4.116
	SRR3591708	Shoot apex	1.326
	SRR3591709	Stem	5.953
	SRR3591710	White floral bud	0.318
	SRR3591711	White flower	0.676
	SRR3591712	Green floral bud	0.640
	SRR3591713	Yellow flower	1.007
SRP173429	SRR8316895	Juvenile bud stage	0.478
	SRR8316896	Juvenile bud stage	0.513
	SRR8316897	Juvenile bud stage	0.583
	SRR8316894	Third green stage	0.459
	SRR8316900	Third green stage	0.167
	SRR8316901	Third green stage	0.244
	SRR8316898	Complete white stage	0.051
	SRR8316899	Complete white stage	0.738
	SRR8316903	Complete white stage	0.012
	SRR8316902	Silver flowering stage	0.356
	SRR8316904	Silver flowering stage	0.415
	SRR8316905	Silver flowering stage	0.714
	SRR8316906	Gold flowering stage	2.106
	SRR8316907	Gold flowering stage	1.497
	SRR8316908	Gold flowering stage	2.179
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.062
	SRR6706288	Light intensity 20%	0.053
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.056
	CNS0095593	Slightly white alabastrum(diploid) 2	0.806
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.030
	CNS0095596	Whole white alabastrum(diploid) 3	0.175
	CNS0095597	Whole white alabastrum(diploid) 4	0.060
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.599
	CNS0095600	Silvery flower (diploied) 3	0.161
	CNS0095601	Golden flower (diploid) 1	0.355
	CNS0095602	Golden flower (diploid) 2	0.718
	CNS0095603	Golden flower (diploid) 3	1.944
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.268
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.418
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.083
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.029
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.107
	CNS0095610	Silvery flower (diploied) 1	2.068
	CNS0095611	Silvery flower (diploied) 2	1.557
	CNS0095612	Silvery flower (diploied) 3	2.292
	CNS0095613	Golden flower (tetraploid) 1	3.586
	CNS0095614	Golden flower (tetraploid) 2	3.285
	CNS0095615	Golden flower (tetraploid) 3	0.982
CRA001975	CRR073297	Stem 1	0.148
	CRR073298	Stem 2	0.113
	CRR073299	Stem 3	0.047
	CRR073300	Leaf 1	0.216
	CRR073301	Leaf 2	0.110
	CRR073302	Leaf 3	0.092
	CRR073303	Juvenile bud 1	0.230
	CRR073304	Juvenile bud 2	0.089
	CRR073305	Juvenile bud 3	0.099
	CRR073306	Third green 1	1.739
	CRR073307	Third green 2	0.468
	CRR073308	Third green 3	0.563
	CRR073309	Second white 1	2.878
	CRR073310	Second white 2	2.047
	CRR073311	Second white 3	3.342
	CRR073312	Silver flowering 1	3.865
	CRR073313	Silver flowering 2	1.399
	CRR073314	Silver flowering 3	3.956
	CRR073315	Gold flowering 1	0.051
	CRR073316	Gold flowering 2	0.367
	CRR073317	Gold flowering 3	0.217
	CRR073318	Tawny withering 1	1.719
	CRR073319	Tawny withering 2	0.788
	CRR073320	Tawny withering 3	0.393