Gene detail

Detail information of GWHGAAZE033109

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010258443.1	1.8771E-112	PREDICTED: vesicle transport v-SNARE 13-like [Nelumbo nucifera]
Swissprot	tr\|Q9LVP9\|VTI13_ARATH	3E-98	Vesicle transport v-SNARE 13
trEMBL	tr\|F6GT59\|F6GT59_VITVI	6E-110	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB43068.1}
TAIR10	AT5G39510.1	3E-67	Vesicle transport v-SNARE family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000094	gene	916065	918025	+
GWHAAZE00000094	mRNA	916065	918025	+
GWHAAZE00000094	exon	916065	916104	+
GWHAAZE00000094	exon	916495	916553	+
GWHAAZE00000094	exon	916646	916834	+
GWHAAZE00000094	exon	917618	917788	+
GWHAAZE00000094	exon	917873	918025	+
GWHAAZE00000094	CDS	916065	916104	+
GWHAAZE00000094	CDS	916495	916553	+
GWHAAZE00000094	CDS	916646	916834	+
GWHAAZE00000094	CDS	917618	917788	+
GWHAAZE00000094	CDS	917873	918025	+

Transcript Sequence
>GWHTAAZE033148 ATGCTGGAGGTTGATTTTCAGCAGCATGATGACCCCAAACAGCAAAAGAAGCAAAAAATTGCTGAAATTAGAGCTGGACTGGATGAAGCAGAATCGCTGATCCGGAAAATGGACCTTGAGGCTAGAAGTTTGCAGCCAAACATAAAGGCTGTTCTCCTTGCTAAGCTAAGGGAATATAAATCTGATCTGAACAATTTGAAAAGTGAAGTTAAACGAATTTCATCAACTAACTTAAATCAGGCTGCTCGAGACGATTTACTGGAATCGGGAATGGCTGATGCACAAACGGTATCAGCGGATCAGAGAGCTAGATTATTGATGTCAACTGAAAGATTAAACAAGTCCAGCGACAGAGTTAGGGAAAGTAGAAAGACCATGTTGGAGACGGAAGAACTCGGTGTCTCAATTCTTCACGATCTGCACCAACAACGACAGTCTCTCTTACACGCCCACGGAACTCTTCACGGAGTGGATGACAACATCAGCAAGAGTAAGAAAATATTGACAGCCATGTCAAGAAGGATGAACAGGAACAAGTGGATCATTGGCTCAATTGTTGCTGTCCTTGTTCTTGCTATTATCTTGATCTTGTACTTCAAATTGAAGAACTAG

Network for GWHGAAZE033109

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05008.16	V-SNARE	12	72	1.40E-18
PF12352.9	V-SNARE_C	110	175	2.40E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08493	VTI1	SNARE interactions in vesicular transport	map04130
K08493	VTI1	Autophagy - yeast	map04138

Gene Ontology

GO term	Ontology	Name
GO:0016192	biological_process	vesicle-mediated transport
GO:0006886	biological_process	intracellular protein transport
GO:0016020	cellular_component	membrane
GO:0005794	cellular_component	Golgi apparatus
GO:0005484	molecular_function	SNAP receptor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	44.911
	SRR3591706	second leaf	20.928
	SRR3591707	mature leaf	24.608
	SRR3591708	Shoot apex	32.192
	SRR3591709	Stem	47.530
	SRR3591710	White floral bud	55.565
	SRR3591711	White flower	32.375
	SRR3591712	Green floral bud	65.841
	SRR3591713	Yellow flower	49.439
SRP173429	SRR8316895	Juvenile bud stage	30.181
	SRR8316896	Juvenile bud stage	46.049
	SRR8316897	Juvenile bud stage	19.995
	SRR8316894	Third green stage	16.995
	SRR8316900	Third green stage	49.630
	SRR8316901	Third green stage	53.539
	SRR8316898	Complete white stage	31.530
	SRR8316899	Complete white stage	75.690
	SRR8316903	Complete white stage	46.577
	SRR8316902	Silver flowering stage	14.108
	SRR8316904	Silver flowering stage	20.113
	SRR8316905	Silver flowering stage	10.647
	SRR8316906	Gold flowering stage	30.125
	SRR8316907	Gold flowering stage	29.986
	SRR8316908	Gold flowering stage	35.061
SRP132670	SRR6706286	Control	22.935
	SRR6706287	Light intensity 50%	26.424
	SRR6706288	Light intensity 20%	28.886
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	52.211
	CNS0095593	Slightly white alabastrum(diploid) 2	44.524
	CNS0095594	Slightly white alabastrum(diploid) 3	46.826
	CNS0095595	Whole white alabastrum(diploid) 2	44.063
	CNS0095596	Whole white alabastrum(diploid) 3	51.312
	CNS0095597	Whole white alabastrum(diploid) 4	44.797
	CNS0095598	Silvery flower (diploied) 1	33.165
	CNS0095599	Silvery flower (diploied) 2	25.364
	CNS0095600	Silvery flower (diploied) 3	39.054
	CNS0095601	Golden flower (diploid) 1	28.515
	CNS0095602	Golden flower (diploid) 2	27.928
	CNS0095603	Golden flower (diploid) 3	31.048
	CNS0095604	Slightly white alabastrum(tetraploid) 1	46.678
	CNS0095605	Slightly white alabastrum(tetraploid) 2	50.461
	CNS0095606	Slightly white alabastrum(tetraploid) 3	30.852
	CNS0095607	Whole white alabastrum(tetraploid) 1	53.934
	CNS0095608	Whole white alabastrum(tetraploid) 2	47.794
	CNS0095609	Whole white alabastrum(tetraploid) 3	42.416
	CNS0095610	Silvery flower (diploied) 1	30.875
	CNS0095611	Silvery flower (diploied) 2	31.399
	CNS0095612	Silvery flower (diploied) 3	41.127
	CNS0095613	Golden flower (tetraploid) 1	27.047
	CNS0095614	Golden flower (tetraploid) 2	22.717
	CNS0095615	Golden flower (tetraploid) 3	36.429
CRA001975	CRR073297	Stem 1	49.538
	CRR073298	Stem 2	40.520
	CRR073299	Stem 3	43.360
	CRR073300	Leaf 1	44.696
	CRR073301	Leaf 2	43.371
	CRR073302	Leaf 3	55.089
	CRR073303	Juvenile bud 1	45.599
	CRR073304	Juvenile bud 2	79.103
	CRR073305	Juvenile bud 3	39.167
	CRR073306	Third green 1	31.863
	CRR073307	Third green 2	46.688
	CRR073308	Third green 3	34.368
	CRR073309	Second white 1	34.025
	CRR073310	Second white 2	29.361
	CRR073311	Second white 3	26.724
	CRR073312	Silver flowering 1	38.828
	CRR073313	Silver flowering 2	39.657
	CRR073314	Silver flowering 3	31.938
	CRR073315	Gold flowering 1	28.429
	CRR073316	Gold flowering 2	38.348
	CRR073317	Gold flowering 3	19.686
	CRR073318	Tawny withering 1	55.252
	CRR073319	Tawny withering 2	63.521
	CRR073320	Tawny withering 3	65.879