Gene detail

Detail information of GWHGAAZE033232

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP45387.1	9.0707E-86	hypothetical protein JCGZ_09636 [Jatropha curcas]
COG	YP_008797956.1	4E-15	ubiquitin-conjugating enzyme E2-like protein
Swissprot	tr\|P42748\|UBC4_ARATH	1E-75	Ubiquitin-conjugating enzyme E2 4
trEMBL	tr\|A0A067LAG2\|A0A067LAG2_JATCU	3E-86	Uncharacterized protein {ECO:0000313\|EMBL:KDP45387.1}
TAIR10	AT5G41340.1	1E-60	ubiquitin conjugating enzyme 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000094	gene	3295150	3298166	+
GWHAAZE00000094	mRNA	3295150	3298166	+
GWHAAZE00000094	exon	3295150	3295193	+
GWHAAZE00000094	exon	3295360	3295439	+
GWHAAZE00000094	exon	3295844	3295896	+
GWHAAZE00000094	exon	3297411	3297550	+
GWHAAZE00000094	exon	3297857	3297909	+
GWHAAZE00000094	exon	3298015	3298166	+
GWHAAZE00000094	CDS	3295150	3295193	+
GWHAAZE00000094	CDS	3295360	3295439	+
GWHAAZE00000094	CDS	3295844	3295896	+
GWHAAZE00000094	CDS	3297411	3297550	+
GWHAAZE00000094	CDS	3297857	3297909	+
GWHAAZE00000094	CDS	3298015	3298166	+

Transcript Sequence
>GWHTAAZE033271 ATGTCTTCTCCAAGCAAGAGGAAAGATATGGATGTAATGAAACTGATGATGAGTGACTATGCTGTGGAGCCGATAAACGATGGGATCAATGAATTTAATGTGGTGTTCCATGGTCCTAAAGAAAATGGATCCACTACCTTAAGTTCTGGTTGTTTTATCTCTTCACTTTTGCTCCAGTGTCGCTTACATATTATTGGTTCAGGCCTTTATGAGGGTGGTGTGTGGAAAGTGCGTGTAGAGCTACCAGATGCTTATCCTTACAAGTCTCCTTCAATAGTATTTCTTAACAAGATTTTCCATCCAAATGTCGATGAACTGTCTGGTTCTGTGTGCTTGGATGTCATAAACCAATCGTGGAGTCCAATGTTTGATCTTTTGAATGTGTTCGAGGTTTTCATTCCTCAGCTTTTGCTTTACCCAAATCCATCGGACCCATTAAATGGTGATGCAGCATCGCTGATGATGAAGGACCAGAAGCAATATGAACAAAAAGTGAAAGGTGAAATATGTATATTTTGCTAA

Network for GWHGAAZE033232

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	57	166	4.70E-34

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K10576	UBE2H, UBC8	Ubiquitin mediated proteolysis	map04120

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.134
	SRR3591706	second leaf	1.708
	SRR3591707	mature leaf	19.855
	SRR3591708	Shoot apex	2.759
	SRR3591709	Stem	8.081
	SRR3591710	White floral bud	102.248
	SRR3591711	White flower	65.832
	SRR3591712	Green floral bud	45.921
	SRR3591713	Yellow flower	47.209
SRP173429	SRR8316895	Juvenile bud stage	17.552
	SRR8316896	Juvenile bud stage	27.503
	SRR8316897	Juvenile bud stage	11.620
	SRR8316894	Third green stage	13.358
	SRR8316900	Third green stage	51.233
	SRR8316901	Third green stage	48.726
	SRR8316898	Complete white stage	53.291
	SRR8316899	Complete white stage	90.914
	SRR8316903	Complete white stage	90.355
	SRR8316902	Silver flowering stage	41.121
	SRR8316904	Silver flowering stage	50.704
	SRR8316905	Silver flowering stage	27.279
	SRR8316906	Gold flowering stage	72.132
	SRR8316907	Gold flowering stage	86.331
	SRR8316908	Gold flowering stage	69.179
SRP132670	SRR6706286	Control	18.277
	SRR6706287	Light intensity 50%	15.676
	SRR6706288	Light intensity 20%	17.518
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	26.716
	CNS0095593	Slightly white alabastrum(diploid) 2	29.254
	CNS0095594	Slightly white alabastrum(diploid) 3	25.277
	CNS0095595	Whole white alabastrum(diploid) 2	34.429
	CNS0095596	Whole white alabastrum(diploid) 3	42.177
	CNS0095597	Whole white alabastrum(diploid) 4	43.950
	CNS0095598	Silvery flower (diploied) 1	36.162
	CNS0095599	Silvery flower (diploied) 2	35.364
	CNS0095600	Silvery flower (diploied) 3	61.434
	CNS0095601	Golden flower (diploid) 1	37.018
	CNS0095602	Golden flower (diploid) 2	42.974
	CNS0095603	Golden flower (diploid) 3	41.147
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.870
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.662
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.955
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.531
	CNS0095608	Whole white alabastrum(tetraploid) 2	15.060
	CNS0095609	Whole white alabastrum(tetraploid) 3	16.363
	CNS0095610	Silvery flower (diploied) 1	48.081
	CNS0095611	Silvery flower (diploied) 2	38.691
	CNS0095612	Silvery flower (diploied) 3	95.597
	CNS0095613	Golden flower (tetraploid) 1	49.408
	CNS0095614	Golden flower (tetraploid) 2	41.219
	CNS0095615	Golden flower (tetraploid) 3	52.902
CRA001975	CRR073297	Stem 1	22.693
	CRR073298	Stem 2	23.822
	CRR073299	Stem 3	17.572
	CRR073300	Leaf 1	27.690
	CRR073301	Leaf 2	23.163
	CRR073302	Leaf 3	17.215
	CRR073303	Juvenile bud 1	32.920
	CRR073304	Juvenile bud 2	35.620
	CRR073305	Juvenile bud 3	24.357
	CRR073306	Third green 1	35.407
	CRR073307	Third green 2	38.666
	CRR073308	Third green 3	36.083
	CRR073309	Second white 1	30.276
	CRR073310	Second white 2	45.666
	CRR073311	Second white 3	24.184
	CRR073312	Silver flowering 1	20.380
	CRR073313	Silver flowering 2	16.836
	CRR073314	Silver flowering 3	20.342
	CRR073315	Gold flowering 1	56.102
	CRR073316	Gold flowering 2	69.850
	CRR073317	Gold flowering 3	33.949
	CRR073318	Tawny withering 1	6.619
	CRR073319	Tawny withering 2	6.450
	CRR073320	Tawny withering 3	3.714