Gene detail

Detail information of GWHGAAZE033344

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006447103.1	3.3E-120	hypothetical protein CICLE_v10016576mg [Citrus clementina]
COG	YP_003475431.1	2E-52	ribulose-phosphate 3-epimerase
Swissprot	tr\|Q9SE42\|RPE1_ORYSJ	1E-115	Ribulose-phosphate 3-epimerase, cytoplasmic isoform
trEMBL	tr\|V4TIU2\|V4TIU2_9ROSI	1E-120	Ribulose-phosphate 3-epimerase {ECO:0000256\|PIRNR:PIRNR001461}
TAIR10	AT3G01850.2	1E-91	Aldolase-type TIM barrel family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000094	gene	5132022	5135259	-
GWHAAZE00000094	mRNA	5132022	5135259	-
GWHAAZE00000094	exon	5132022	5132165	-
GWHAAZE00000094	exon	5134154	5134195	-
GWHAAZE00000094	exon	5134298	5134390	-
GWHAAZE00000094	exon	5134572	5134669	-
GWHAAZE00000094	exon	5134765	5134871	-
GWHAAZE00000094	exon	5135002	5135064	-
GWHAAZE00000094	exon	5135192	5135259	-
GWHAAZE00000094	CDS	5135192	5135259	-
GWHAAZE00000094	CDS	5135002	5135064	-
GWHAAZE00000094	CDS	5134765	5134871	-
GWHAAZE00000094	CDS	5134572	5134669	-
GWHAAZE00000094	CDS	5134298	5134390	-
GWHAAZE00000094	CDS	5134154	5134195	-
GWHAAZE00000094	CDS	5132022	5132165	-

Transcript Sequence
>GWHTAAZE033383 ATGTCTTCGTTGCTGATACCTTCTGTTGATTCATCTGCAGGATGGGTAGGTTTTGAACAAAGCTCATGGCACTTTGTCCCAAACCTCACTCTTGGTGCTCCCGTCATTCAGAGTCTGAGAAAGCACACCAAGGCATATCTAGATTGCCACCTTATGGTCACGAATCCTCTTGATTATGTGGAACAATTAGGAAAAGCTGGTGCTTCAGGTTTTACGTTTCACGTTGAGGCATCCAAAGATAATTGGCAAGAAATTGTCCAACAAATCAAGTCAAAGGGCATGCGGCCTGGTGTTGCATTAAAGCCTGGAACACCCATTGAAGAAGTGTACCCCTTGCTTGAAGGTGAAAATCCAGTGGAAATGGTTCTTGTCATGACCGTTGAACCTGGATTTGGCGGACAAAAGTTCATGCCAGAAATGATGGATAAGGTACGTGTGCTGAGAAAGAAGTATCCTTCACTTGATATAGAGGTAGATGGGGGTTTAGGGCCGTCAACAATCAGCGTGGCAGCTTCAGCCGGAGCAAACTGCATAGTTGCTGGAAGTTCGGTGTTTGGAGCTCCTGAGCCTGCTCATGTTATTTCCCTTTTGAGAAAGTCTGTGGAGGAAGCTGCG

Network for GWHGAAZE033344

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00834.20	Ribul_P_3_epim	14	185	9.30E-55

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01783	rpe, RPE	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Carbon metabolism	map01200
		Biosynthesis of amino acids	map01230
		Pentose phosphate pathway	map00030
		Pentose and glucuronate interconversions	map00040
		Carbon fixation in photosynthetic organisms	map00710

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0016857	molecular_function	racemase and epimerase activity, acting on carbohydrates and derivatives
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	57.384
	SRR3591706	second leaf	46.564
	SRR3591707	mature leaf	50.267
	SRR3591708	Shoot apex	49.368
	SRR3591709	Stem	112.810
	SRR3591710	White floral bud	90.724
	SRR3591711	White flower	130.691
	SRR3591712	Green floral bud	69.725
	SRR3591713	Yellow flower	134.216
SRP173429	SRR8316895	Juvenile bud stage	33.509
	SRR8316896	Juvenile bud stage	46.077
	SRR8316897	Juvenile bud stage	18.427
	SRR8316894	Third green stage	19.724
	SRR8316900	Third green stage	71.017
	SRR8316901	Third green stage	67.204
	SRR8316898	Complete white stage	45.115
	SRR8316899	Complete white stage	89.625
	SRR8316903	Complete white stage	54.173
	SRR8316902	Silver flowering stage	55.246
	SRR8316904	Silver flowering stage	65.785
	SRR8316905	Silver flowering stage	38.348
	SRR8316906	Gold flowering stage	135.404
	SRR8316907	Gold flowering stage	131.134
	SRR8316908	Gold flowering stage	151.036
SRP132670	SRR6706286	Control	65.323
	SRR6706287	Light intensity 50%	68.444
	SRR6706288	Light intensity 20%	76.017
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	54.301
	CNS0095593	Slightly white alabastrum(diploid) 2	87.641
	CNS0095594	Slightly white alabastrum(diploid) 3	61.828
	CNS0095595	Whole white alabastrum(diploid) 2	57.891
	CNS0095596	Whole white alabastrum(diploid) 3	59.847
	CNS0095597	Whole white alabastrum(diploid) 4	59.839
	CNS0095598	Silvery flower (diploied) 1	61.774
	CNS0095599	Silvery flower (diploied) 2	64.684
	CNS0095600	Silvery flower (diploied) 3	112.370
	CNS0095601	Golden flower (diploid) 1	74.756
	CNS0095602	Golden flower (diploid) 2	87.886
	CNS0095603	Golden flower (diploid) 3	83.391
	CNS0095604	Slightly white alabastrum(tetraploid) 1	55.405
	CNS0095605	Slightly white alabastrum(tetraploid) 2	48.382
	CNS0095606	Slightly white alabastrum(tetraploid) 3	70.447
	CNS0095607	Whole white alabastrum(tetraploid) 1	37.731
	CNS0095608	Whole white alabastrum(tetraploid) 2	44.389
	CNS0095609	Whole white alabastrum(tetraploid) 3	50.901
	CNS0095610	Silvery flower (diploied) 1	109.341
	CNS0095611	Silvery flower (diploied) 2	119.020
	CNS0095612	Silvery flower (diploied) 3	119.363
	CNS0095613	Golden flower (tetraploid) 1	91.223
	CNS0095614	Golden flower (tetraploid) 2	100.306
	CNS0095615	Golden flower (tetraploid) 3	68.388
CRA001975	CRR073297	Stem 1	47.050
	CRR073298	Stem 2	51.853
	CRR073299	Stem 3	48.527
	CRR073300	Leaf 1	67.650
	CRR073301	Leaf 2	61.122
	CRR073302	Leaf 3	73.025
	CRR073303	Juvenile bud 1	89.407
	CRR073304	Juvenile bud 2	89.480
	CRR073305	Juvenile bud 3	82.921
	CRR073306	Third green 1	138.522
	CRR073307	Third green 2	111.405
	CRR073308	Third green 3	104.206
	CRR073309	Second white 1	135.790
	CRR073310	Second white 2	123.757
	CRR073311	Second white 3	78.398
	CRR073312	Silver flowering 1	84.046
	CRR073313	Silver flowering 2	91.297
	CRR073314	Silver flowering 3	79.696
	CRR073315	Gold flowering 1	31.651
	CRR073316	Gold flowering 2	33.336
	CRR073317	Gold flowering 3	28.004
	CRR073318	Tawny withering 1	79.874
	CRR073319	Tawny withering 2	86.609
	CRR073320	Tawny withering 3	68.034