Gene detail

Detail information of GWHGAAZE033526

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010242709.1	0	PREDICTED: acyl-[acyl-carrier-protein] desaturase, chloroplastic [Nelumbo nucifera]
COG	YP_006369323.1	5E-27	Fatty acid desaturase
Swissprot	tr\|P32061\|STAD_CUCSA	0	Acyl-[acyl-carrier-protein] desaturase, chloroplastic (Precursor)
trEMBL	tr\|F6GZC7\|F6GZC7_VITVI	0	Acyl-[acyl-carrier-protein] desaturase {ECO:0000256\|RuleBase:RU000582}
TAIR10	AT2G43710.1	3E-148	Plant stearoyl-acyl-carrier-protein desaturase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000104	gene	1712435	1715126	-
GWHAAZE00000104	mRNA	1712435	1715126	-
GWHAAZE00000104	exon	1712435	1712995	-
GWHAAZE00000104	exon	1714689	1715126	-
GWHAAZE00000104	CDS	1714689	1715126	-
GWHAAZE00000104	CDS	1712435	1712995	-

Transcript Sequence
>GWHTAAZE033565 ATGCCACCCCAAAAGATAGAACTATTCAAATCCCTAGATGGATGGGCCAAAGACAACATGTTGGTCCACTTAAAACCTGTTGAAAAATGCTGGCAGCCTCAAGATTTTTTGCCTGACCCAAAACATGAAGGATTTACTGAGCAAATAGAAGAATTGAGAGAGAGGGCAAAAGGGTTACCAGATGAGTATTTTGTTGTTTTAGTAGGAGATATGGTCACTGAAGAAGCACTTCCAACTTACCAAACATTTCTTAATAGTAATGATGGGACTAGAGATGAGACTTGTTCAAGTTTGAGTCCATGGGCTATTTGGACAAGGGGGTGGACCGGTGAAGAGAATAGGCATGGTGATCTTCTCAATAAATATCTTTATTTGTGTGGGAGGGTTGATATGAAGCAAGTTGAGAAGACTATTCAGTATCTCATTGGGTCTGGAATGGATTTTCAAACAGAAAACAACCCTTACCTAGCGTTCATTTACACATCATTCCAAGAAAGGGCAACCGCCATTTCTCATGGCAACACATCAAAGCTGGCCAAGAAATATGGAGACAAAAACTTGGCTCAAATATGCGGCATAATAGCCTCCGATGAGAAGCGCCATGAAGCCGCTTACACAAAAGTAGTCGCAAAACTCTTCGAGATCGATCCAAATGACACCATTATAGCATTTTCCAACATGATGAAGAAGAAAATCTCTATGCCGGCCCACTTTATGTACGACGGTTATGATGATAATTTGTTCCTAAATTTCAAAGCCGTGGCTCAAAGACTTGGGGTCTATACGGCCAAGGATTATGCCGATATTTTGGAGTTTTTGGTAAAAAAATGGGATGTTGAAAGGTTAAGTGGGCTCTCAAGTGAAGGGAGAAAGGCGCGGGATTATGTTTGCGAGTTGGCTCCGAGGATTCGAAAGCTTGAAGAGAGGGCTCACATGAAGGCCAAGAAAGTGGATTGCTCTTTTAGTTGGATTTTCGATGATCAAGTGAAGTTTGAATGA

Network for GWHGAAZE033526

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03405.15	FA_desaturase_2	5	325	7.70E-151

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03921	FAB2, SSI2, desA1	Metabolic pathways	map01100
		Fatty acid metabolism	map01212
		Fatty acid biosynthesis	map00061
		Biosynthesis of unsaturated fatty acids	map01040

Gene Ontology

GO term	Ontology	Name
GO:0006631	biological_process	fatty acid metabolic process
GO:0055114	biological_process	oxidation-reduction process
GO:0045300	molecular_function	acyl-[acyl-carrier-protein] desaturase activity
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.117
	SRR3591710	White floral bud	48.913
	SRR3591711	White flower	19.262
	SRR3591712	Green floral bud	1.703
	SRR3591713	Yellow flower	8.476
SRP173429	SRR8316895	Juvenile bud stage	0.908
	SRR8316896	Juvenile bud stage	0.462
	SRR8316897	Juvenile bud stage	0.449
	SRR8316894	Third green stage	0.679
	SRR8316900	Third green stage	32.006
	SRR8316901	Third green stage	10.124
	SRR8316898	Complete white stage	595.583
	SRR8316899	Complete white stage	4.162
	SRR8316903	Complete white stage	877.553
	SRR8316902	Silver flowering stage	2362.865
	SRR8316904	Silver flowering stage	3187.365
	SRR8316905	Silver flowering stage	1931.480
	SRR8316906	Gold flowering stage	4295.045
	SRR8316907	Gold flowering stage	4191.056
	SRR8316908	Gold flowering stage	2956.549
SRP132670	SRR6706286	Control	40.131
	SRR6706287	Light intensity 50%	84.855
	SRR6706288	Light intensity 20%	25.814
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.391
	CNS0095593	Slightly white alabastrum(diploid) 2	4.438
	CNS0095594	Slightly white alabastrum(diploid) 3	5.650
	CNS0095595	Whole white alabastrum(diploid) 2	5.435
	CNS0095596	Whole white alabastrum(diploid) 3	5.150
	CNS0095597	Whole white alabastrum(diploid) 4	6.756
	CNS0095598	Silvery flower (diploied) 1	789.796
	CNS0095599	Silvery flower (diploied) 2	915.846
	CNS0095600	Silvery flower (diploied) 3	3559.623
	CNS0095601	Golden flower (diploid) 1	1112.993
	CNS0095602	Golden flower (diploid) 2	2208.469
	CNS0095603	Golden flower (diploid) 3	2226.259
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.985
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.207
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.383
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.982
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.302
	CNS0095609	Whole white alabastrum(tetraploid) 3	19.584
	CNS0095610	Silvery flower (diploied) 1	2184.815
	CNS0095611	Silvery flower (diploied) 2	3610.904
	CNS0095612	Silvery flower (diploied) 3	4967.869
	CNS0095613	Golden flower (tetraploid) 1	2775.889
	CNS0095614	Golden flower (tetraploid) 2	2292.210
	CNS0095615	Golden flower (tetraploid) 3	1983.783
CRA001975	CRR073297	Stem 1	2.593
	CRR073298	Stem 2	2.686
	CRR073299	Stem 3	1.869
	CRR073300	Leaf 1	12.108
	CRR073301	Leaf 2	6.975
	CRR073302	Leaf 3	12.804
	CRR073303	Juvenile bud 1	4.493
	CRR073304	Juvenile bud 2	15.253
	CRR073305	Juvenile bud 3	2.540
	CRR073306	Third green 1	4310.412
	CRR073307	Third green 2	2281.777
	CRR073308	Third green 3	2846.849
	CRR073309	Second white 1	2578.708
	CRR073310	Second white 2	2586.146
	CRR073311	Second white 3	1954.362
	CRR073312	Silver flowering 1	464.150
	CRR073313	Silver flowering 2	236.424
	CRR073314	Silver flowering 3	428.512
	CRR073315	Gold flowering 1	0.586
	CRR073316	Gold flowering 2	0.083
	CRR073317	Gold flowering 3	0.959
	CRR073318	Tawny withering 1	0.256
	CRR073319	Tawny withering 2	0.774
	CRR073320	Tawny withering 3	0.038