Gene detail

Detail information of GWHGAAZE033548

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011043934.1	4.0226E-106	PREDICTED: peroxidase 45-like [Populus euphratica]
Swissprot	tr\|Q96522\|PER45_ARATH	5E-99	Peroxidase 45 (Precursor)
trEMBL	tr\|B9ILW4\|B9ILW4_POPTR	7E-105	Peroxidase 16 family protein {ECO:0000313\|EMBL:EEF03028.1}
TAIR10	AT4G30170.1	4E-80	Peroxidase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000108	gene	1142793	1144691	-
GWHAAZE00000108	mRNA	1142793	1144691	-
GWHAAZE00000108	exon	1144536	1144691	-
GWHAAZE00000108	exon	1143853	1144018	-
GWHAAZE00000108	exon	1142793	1143061	-
GWHAAZE00000108	CDS	1144536	1144691	-
GWHAAZE00000108	CDS	1143853	1144018	-
GWHAAZE00000108	CDS	1142793	1143061	-

Transcript Sequence
>GWHTAAZE033587 ATGGAGAAGGATCACCCAGACGATATATCGCTCGCTGGAGATGGATTCGACACAGTGATAAAAGCAAAGGCAGCTCTCGATGCTGATCCCAACTGTAAAAACAAAGTTTCTTGTGCAGATATTTTAGCTTTGGCTACCAGAGATGTTGTAGCTTTGACTGGAGGGCCATCATACAAAGTGGAATTGGGAAGAAGAGATGGGAGAATATCAACAATAGCAAGTGTACAACATAGGCTTCCACACCCAGATTTTGGATTGGATAAGCTTAATTCCATGTTTGCCTCTAATGGCCTCTCCCAGACCGATATGATTGCGCTCTCTGACCCAAGGATAGCAATTAACATGGACCCAAACACCCCCCAAAGATTGGACAACGCGTACTACCAAAACCTTCAGCAAGGCAAGGGCTTGTTTGGCTCGGATCAAATACTCCATGAGGATCAAAGGTCAAAGCCTACCGTTGACTTATTCGCCTCTAGCAATTCAGCTTTTCAACAAGCATTTGTCACTGCCATTACCAAGTTGGGTCGGGTCGGAGTTTTGACAGGGAATCAAGGCGAGATCCGACGCGATTGCGCGGCCGTGAATTAA

Network for GWHGAAZE033548

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00141.24	peroxidase	2	107	3.40E-25
PF00141.24	peroxidase	112	160	3.80E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00430	E1.11.1.7	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Phenylpropanoid biosynthesis	map00940

Gene Ontology

GO term	Ontology	Name
GO:0006979	biological_process	response to oxidative stress
GO:0055114	biological_process	oxidation-reduction process
GO:0004601	molecular_function	peroxidase activity
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	71.477
	SRR3591706	second leaf	0.460
	SRR3591707	mature leaf	0.155
	SRR3591708	Shoot apex	10.339
	SRR3591709	Stem	13.999
	SRR3591710	White floral bud	6.901
	SRR3591711	White flower	22.508
	SRR3591712	Green floral bud	3.492
	SRR3591713	Yellow flower	168.220
SRP173429	SRR8316895	Juvenile bud stage	0.863
	SRR8316896	Juvenile bud stage	1.257
	SRR8316897	Juvenile bud stage	0.007
	SRR8316894	Third green stage	0.273
	SRR8316900	Third green stage	1.791
	SRR8316901	Third green stage	2.112
	SRR8316898	Complete white stage	12.168
	SRR8316899	Complete white stage	6.433
	SRR8316903	Complete white stage	12.410
	SRR8316902	Silver flowering stage	4.255
	SRR8316904	Silver flowering stage	9.951
	SRR8316905	Silver flowering stage	3.903
	SRR8316906	Gold flowering stage	26.357
	SRR8316907	Gold flowering stage	33.211
	SRR8316908	Gold flowering stage	17.953
SRP132670	SRR6706286	Control	10.736
	SRR6706287	Light intensity 50%	9.300
	SRR6706288	Light intensity 20%	6.687
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.272
	CNS0095593	Slightly white alabastrum(diploid) 2	2.733
	CNS0095594	Slightly white alabastrum(diploid) 3	2.478
	CNS0095595	Whole white alabastrum(diploid) 2	1.386
	CNS0095596	Whole white alabastrum(diploid) 3	0.840
	CNS0095597	Whole white alabastrum(diploid) 4	3.121
	CNS0095598	Silvery flower (diploied) 1	21.640
	CNS0095599	Silvery flower (diploied) 2	25.609
	CNS0095600	Silvery flower (diploied) 3	39.979
	CNS0095601	Golden flower (diploid) 1	50.617
	CNS0095602	Golden flower (diploid) 2	122.362
	CNS0095603	Golden flower (diploid) 3	120.063
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.203
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.203
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.271
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.266
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.076
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.998
	CNS0095610	Silvery flower (diploied) 1	27.754
	CNS0095611	Silvery flower (diploied) 2	20.552
	CNS0095612	Silvery flower (diploied) 3	11.457
	CNS0095613	Golden flower (tetraploid) 1	91.596
	CNS0095614	Golden flower (tetraploid) 2	66.705
	CNS0095615	Golden flower (tetraploid) 3	56.299
CRA001975	CRR073297	Stem 1	0.719
	CRR073298	Stem 2	0.630
	CRR073299	Stem 3	0.953
	CRR073300	Leaf 1	2.038
	CRR073301	Leaf 2	2.171
	CRR073302	Leaf 3	1.443
	CRR073303	Juvenile bud 1	2.679
	CRR073304	Juvenile bud 2	5.987
	CRR073305	Juvenile bud 3	4.187
	CRR073306	Third green 1	5.978
	CRR073307	Third green 2	5.848
	CRR073308	Third green 3	10.692
	CRR073309	Second white 1	5.671
	CRR073310	Second white 2	7.571
	CRR073311	Second white 3	2.446
	CRR073312	Silver flowering 1	11.197
	CRR073313	Silver flowering 2	7.838
	CRR073314	Silver flowering 3	27.742
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.344
	CRR073317	Gold flowering 3	0.755
	CRR073318	Tawny withering 1	29.739
	CRR073319	Tawny withering 2	23.805
	CRR073320	Tawny withering 3	20.695