Gene detail

Detail information of GWHGAAZE033685

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007014229.1	5.75412E-62	Kinase, putative [Theobroma cacao]
Swissprot	tr\|Q9XID3\|Y1343_ARATH	8E-22	G-type lectin S-receptor-like serine/threonine-protein kinase At1g34300 (Precursor)
trEMBL	tr\|I1MGY7\|I1MGY7_SOYBN	1E-62	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA15G17450.1}
TAIR10	AT1G34300.1	6E-20	lectin protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000115	gene	232172	232702	+
GWHAAZE00000115	mRNA	232172	232702	+
GWHAAZE00000115	exon	232172	232702	+
GWHAAZE00000115	CDS	232172	232702	+

Transcript Sequence
>GWHTAAZE033725 ATGACACTGACTGGAAATCGAGGGACCCCTGGATATGCTGCACCGGAAATGTGGATGCCATATCCGGTGACCCAAAAATGCGATGTTTACAGTTTTGGGATGCTTTTGTTTGAGATTTTGGGGAGGCGAAGAAACTTTGACTTGAATTTACCGGAAAGTCAAGAGTGGTTTCCCAAATGGGTTTGGAAGAAATTTGACAAAGGAAAGTTGTCGGAGGTGATGGATGTTTGCGCTATTGAAGAGATGGACAGAGGGAAAGCAGGAAGAATGGCTGTAATTGCTTTATGTTGTGTGCAGTATAATTCGGAGAGTAGGCCGTTAATGAGTGAGGTGGTGAAGATGTTGGAAGGTGGGGTTGATATTCCGATTCCGAAAAACCCATTTCCATGTTTTTTTGAAGTAACGGATAGAGCTTGCGGTTTAGTCCCGGGATCCACTCGAGTGTCAACTGAAACTGATTATTCTTCTGTGTCCCCTGTTGTAAGGAACAATGAGATTGAAATAGTTACGACCTGTGGAAGACTTGATTGA

Network for GWHGAAZE033685

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	11	115	5.80E-07

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_RLCK-Os

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.057
	SRR3591706	second leaf	0.617
	SRR3591707	mature leaf	0.477
	SRR3591708	Shoot apex	1.172
	SRR3591709	Stem	2.420
	SRR3591710	White floral bud	0.473
	SRR3591711	White flower	1.386
	SRR3591712	Green floral bud	0.993
	SRR3591713	Yellow flower	0.426
SRP173429	SRR8316895	Juvenile bud stage	1.378
	SRR8316896	Juvenile bud stage	2.190
	SRR8316897	Juvenile bud stage	0.909
	SRR8316894	Third green stage	0.631
	SRR8316900	Third green stage	1.253
	SRR8316901	Third green stage	2.747
	SRR8316898	Complete white stage	0.230
	SRR8316899	Complete white stage	1.220
	SRR8316903	Complete white stage	0.988
	SRR8316902	Silver flowering stage	0.069
	SRR8316904	Silver flowering stage	0.611
	SRR8316905	Silver flowering stage	0.192
	SRR8316906	Gold flowering stage	0.070
	SRR8316907	Gold flowering stage	0.369
	SRR8316908	Gold flowering stage	0.546
SRP132670	SRR6706286	Control	0.545
	SRR6706287	Light intensity 50%	0.897
	SRR6706288	Light intensity 20%	0.809
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.324
	CNS0095593	Slightly white alabastrum(diploid) 2	2.909
	CNS0095594	Slightly white alabastrum(diploid) 3	1.868
	CNS0095595	Whole white alabastrum(diploid) 2	1.757
	CNS0095596	Whole white alabastrum(diploid) 3	1.589
	CNS0095597	Whole white alabastrum(diploid) 4	1.677
	CNS0095598	Silvery flower (diploied) 1	0.942
	CNS0095599	Silvery flower (diploied) 2	1.351
	CNS0095600	Silvery flower (diploied) 3	0.649
	CNS0095601	Golden flower (diploid) 1	0.641
	CNS0095602	Golden flower (diploid) 2	0.219
	CNS0095603	Golden flower (diploid) 3	0.426
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.260
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.521
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.768
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.036
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.654
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.312
	CNS0095610	Silvery flower (diploied) 1	0.294
	CNS0095611	Silvery flower (diploied) 2	0.127
	CNS0095612	Silvery flower (diploied) 3	0.081
	CNS0095613	Golden flower (tetraploid) 1	0.963
	CNS0095614	Golden flower (tetraploid) 2	0.649
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	3.032
	CRR073298	Stem 2	1.637
	CRR073299	Stem 3	0.227
	CRR073300	Leaf 1	2.702
	CRR073301	Leaf 2	1.965
	CRR073302	Leaf 3	0.257
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.133
	CRR073305	Juvenile bud 3	0.409
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.176
	CRR073308	Third green 3	0.295
	CRR073309	Second white 1	0.003
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.320
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.419
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.802
	CRR073319	Tawny withering 2	1.530
	CRR073320	Tawny withering 3	1.398