Gene detail

Detail information of GWHGAAZE033783

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011093636.1	1.50117E-72	PREDICTED: hexokinase-1 [Sesamum indicum]
COG	YP_007945726.1	0.0000008	hexokinase
Swissprot	tr\|Q9SEK3\|HXK1_SPIOL	2E-66	Hexokinase-1
trEMBL	tr\|S4SKB5\|S4SKB5_ACTDE	4E-68	Hexokinase {ECO:0000313\|EMBL:AFO84084.1}
TAIR10	AT4G29130.1	8E-44	hexokinase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000136	gene	167203	168237	+
GWHAAZE00000136	mRNA	167203	168237	+
GWHAAZE00000136	exon	167203	167292	+
GWHAAZE00000136	exon	167896	168237	+
GWHAAZE00000136	CDS	167203	167292	+
GWHAAZE00000136	CDS	167896	168237	+

Transcript Sequence
>GWHTAAZE033823 ATGTATAGGACTCCTGATATGTCTGCAATGCATCACGATGAGTCTCCAGATCTCAAGGTGGTTGGGAGCAAGCTTAAGGACATCTTAGAGATACCTACTTCTTTGAAAACGAGGAAAGCAATTGTGGTTCTTTGTGACATTGTTGCGACACGTGGGGCCCGGCTCTCTGCCGCTGGGATCCTAGGCATCCTTAGGAAATTGGGAAGAGACACAGAGAAATTGGACGGGACGCTAAAATCGGTAATAGCATTAGATGGTGGACTTTTTGAACATTATACCAAATTCAGAAATTGCATGGAGAGCACTCTCAAGGAATTAATGGGAGATTTTTCGGAAAGCATTGTGATTGAGCATTCTAGTGACGGCTCAGGCATTGGAGCTGCCCTTTTAGCAGCTTCGCACTCGCAGTACCTCGAAGTTGACAAGTCGTAA

Network for GWHGAAZE033783

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03727.17	Hexokinase_2	3	132	4.10E-31

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00844	HK	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Carbon metabolism	map01200
		Glycolysis / Gluconeogenesis	map00010
		Fructose and mannose metabolism	map00051
		Galactose metabolism	map00052
		Starch and sucrose metabolism	map00500
		Amino sugar and nucleotide sugar metabolism	map00520
		Streptomycin biosynthesis	map00521
		Neomycin, kanamycin and gentamicin biosynthesis	map00524
		HIF-1 signaling pathway	map04066
		Insulin signaling pathway	map04910
		Carbohydrate digestion and absorption	map04973

Gene Ontology

GO term	Ontology	Name
GO:0001678	biological_process	cellular glucose homeostasis
GO:0005975	biological_process	carbohydrate metabolic process
GO:0004396	molecular_function	hexokinase activity
GO:0005524	molecular_function	ATP binding
GO:0005536	molecular_function	glucose binding
GO:0016773	molecular_function	phosphotransferase activity, alcohol group as acceptor

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	15.790
	SRR3591706	second leaf	3.708
	SRR3591707	mature leaf	1.803
	SRR3591708	Shoot apex	14.764
	SRR3591709	Stem	6.634
	SRR3591710	White floral bud	118.538
	SRR3591711	White flower	28.054
	SRR3591712	Green floral bud	45.169
	SRR3591713	Yellow flower	10.028
SRP173429	SRR8316895	Juvenile bud stage	10.940
	SRR8316896	Juvenile bud stage	13.651
	SRR8316897	Juvenile bud stage	8.287
	SRR8316894	Third green stage	7.304
	SRR8316900	Third green stage	33.895
	SRR8316901	Third green stage	25.990
	SRR8316898	Complete white stage	36.913
	SRR8316899	Complete white stage	54.842
	SRR8316903	Complete white stage	61.841
	SRR8316902	Silver flowering stage	17.731
	SRR8316904	Silver flowering stage	16.209
	SRR8316905	Silver flowering stage	7.333
	SRR8316906	Gold flowering stage	13.707
	SRR8316907	Gold flowering stage	15.030
	SRR8316908	Gold flowering stage	32.862
SRP132670	SRR6706286	Control	29.514
	SRR6706287	Light intensity 50%	27.826
	SRR6706288	Light intensity 20%	26.418
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	14.907
	CNS0095593	Slightly white alabastrum(diploid) 2	17.926
	CNS0095594	Slightly white alabastrum(diploid) 3	14.667
	CNS0095595	Whole white alabastrum(diploid) 2	11.355
	CNS0095596	Whole white alabastrum(diploid) 3	13.510
	CNS0095597	Whole white alabastrum(diploid) 4	16.737
	CNS0095598	Silvery flower (diploied) 1	13.493
	CNS0095599	Silvery flower (diploied) 2	16.525
	CNS0095600	Silvery flower (diploied) 3	24.128
	CNS0095601	Golden flower (diploid) 1	7.936
	CNS0095602	Golden flower (diploid) 2	14.616
	CNS0095603	Golden flower (diploid) 3	13.916
	CNS0095604	Slightly white alabastrum(tetraploid) 1	21.504
	CNS0095605	Slightly white alabastrum(tetraploid) 2	18.354
	CNS0095606	Slightly white alabastrum(tetraploid) 3	33.869
	CNS0095607	Whole white alabastrum(tetraploid) 1	19.877
	CNS0095608	Whole white alabastrum(tetraploid) 2	17.689
	CNS0095609	Whole white alabastrum(tetraploid) 3	24.745
	CNS0095610	Silvery flower (diploied) 1	42.846
	CNS0095611	Silvery flower (diploied) 2	29.933
	CNS0095612	Silvery flower (diploied) 3	56.625
	CNS0095613	Golden flower (tetraploid) 1	19.249
	CNS0095614	Golden flower (tetraploid) 2	26.471
	CNS0095615	Golden flower (tetraploid) 3	19.394
CRA001975	CRR073297	Stem 1	22.814
	CRR073298	Stem 2	22.051
	CRR073299	Stem 3	25.147
	CRR073300	Leaf 1	52.014
	CRR073301	Leaf 2	50.957
	CRR073302	Leaf 3	38.468
	CRR073303	Juvenile bud 1	80.079
	CRR073304	Juvenile bud 2	58.202
	CRR073305	Juvenile bud 3	139.212
	CRR073306	Third green 1	79.825
	CRR073307	Third green 2	86.819
	CRR073308	Third green 3	90.147
	CRR073309	Second white 1	39.907
	CRR073310	Second white 2	25.557
	CRR073311	Second white 3	19.433
	CRR073312	Silver flowering 1	21.543
	CRR073313	Silver flowering 2	26.981
	CRR073314	Silver flowering 3	25.494
	CRR073315	Gold flowering 1	5.110
	CRR073316	Gold flowering 2	5.383
	CRR073317	Gold flowering 3	8.129
	CRR073318	Tawny withering 1	7.859
	CRR073319	Tawny withering 2	8.212
	CRR073320	Tawny withering 3	12.579