Gene detail

Detail information of GWHGAAZE005235

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI28643.3	6.278E-109	unnamed protein product [Vitis vinifera]
trEMBL	tr\|D7TDS0\|D7TDS0_VITVI	2E-109	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI28643.3}
TAIR10	AT5G38890.1	6E-68	Nucleic acid-binding, OB-fold-like protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	4679618	4683502	-
GWHAAZE00000002	mRNA	4679618	4683502	-
GWHAAZE00000002	exon	4679618	4679706	-
GWHAAZE00000002	exon	4679918	4679999	-
GWHAAZE00000002	exon	4680933	4681035	-
GWHAAZE00000002	exon	4682362	4682450	-
GWHAAZE00000002	exon	4682796	4682870	-
GWHAAZE00000002	exon	4683377	4683502	-
GWHAAZE00000002	CDS	4683377	4683502	-
GWHAAZE00000002	CDS	4682796	4682870	-
GWHAAZE00000002	CDS	4682362	4682450	-
GWHAAZE00000002	CDS	4680933	4681035	-
GWHAAZE00000002	CDS	4679918	4679999	-
GWHAAZE00000002	CDS	4679618	4679706	-

Transcript Sequence
>GWHTAAZE005241 ATGGGGAAGGCGTCGAGCATGAAAGCAGGGAGGGGTGTTTATGTAGCAGCCCATAACAACACCTTGTACGCTTCCCTCACTGGACGCCCTTCAATCATCCCTCCTTCCCCGGACTCTCTCGACCAGAGACCAACTGTGGAAGTTACTGGTCACAAGGCCCATGGTGCTGTCCCTGAGCCTGGTTCTGTTGTCATTGCCAGAGTTACTAAGGTGATGGCTAGAATGGCTTCTGCAGATATAATGTGTGTTGGTCCCAAATCTGTACGAGAAAAGTTCACAGGCACCATTAGGCAGCAAGATGTCAGGGCAACTGAGATTGACAAAGTTGATATGCATTCATCCTTTCGCCCGGGTGACATTGTTAGAGCTTTAGTAGTATCCTCCCTTCTTAAACTATCCCTTGGAGATGCACAAGCATATTATCTAACTACTGCAAAAAATGAATTGGGTGTTGTGTCTGCGGAAAGCGTGGCAGGTGCAACAATGGTTCCGGTTAGTTGGACAGAGATGCAATGTCCATTGACGGGTCAAATTGAGCAGAGAAAGGTTGCTAAGGTAGCTTGA

Network for GWHGAAZE005235

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF10447.10	EXOSC1	87	127	3.30E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07573	CSL4, EXOSC1	RNA degradation	map03018

Gene Ontology

GO term	Ontology	Name
GO:0000178	cellular_component	exosome (RNase complex)
GO:0003723	molecular_function	RNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	17.479
	SRR3591706	second leaf	8.701
	SRR3591707	mature leaf	10.602
	SRR3591708	Shoot apex	22.736
	SRR3591709	Stem	16.502
	SRR3591710	White floral bud	11.127
	SRR3591711	White flower	18.887
	SRR3591712	Green floral bud	22.670
	SRR3591713	Yellow flower	11.300
SRP173429	SRR8316895	Juvenile bud stage	18.125
	SRR8316896	Juvenile bud stage	23.917
	SRR8316897	Juvenile bud stage	16.381
	SRR8316894	Third green stage	9.575
	SRR8316900	Third green stage	35.358
	SRR8316901	Third green stage	26.910
	SRR8316898	Complete white stage	3.354
	SRR8316899	Complete white stage	34.468
	SRR8316903	Complete white stage	6.686
	SRR8316902	Silver flowering stage	6.743
	SRR8316904	Silver flowering stage	6.380
	SRR8316905	Silver flowering stage	3.255
	SRR8316906	Gold flowering stage	11.577
	SRR8316907	Gold flowering stage	10.096
	SRR8316908	Gold flowering stage	18.451
SRP132670	SRR6706286	Control	21.259
	SRR6706287	Light intensity 50%	24.441
	SRR6706288	Light intensity 20%	27.624
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	23.223
	CNS0095593	Slightly white alabastrum(diploid) 2	27.925
	CNS0095594	Slightly white alabastrum(diploid) 3	20.314
	CNS0095595	Whole white alabastrum(diploid) 2	18.398
	CNS0095596	Whole white alabastrum(diploid) 3	23.299
	CNS0095597	Whole white alabastrum(diploid) 4	18.718
	CNS0095598	Silvery flower (diploied) 1	19.033
	CNS0095599	Silvery flower (diploied) 2	18.127
	CNS0095600	Silvery flower (diploied) 3	12.767
	CNS0095601	Golden flower (diploid) 1	14.990
	CNS0095602	Golden flower (diploid) 2	15.222
	CNS0095603	Golden flower (diploid) 3	10.265
	CNS0095604	Slightly white alabastrum(tetraploid) 1	25.736
	CNS0095605	Slightly white alabastrum(tetraploid) 2	26.553
	CNS0095606	Slightly white alabastrum(tetraploid) 3	37.049
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.559
	CNS0095608	Whole white alabastrum(tetraploid) 2	11.771
	CNS0095609	Whole white alabastrum(tetraploid) 3	30.563
	CNS0095610	Silvery flower (diploied) 1	24.349
	CNS0095611	Silvery flower (diploied) 2	23.260
	CNS0095612	Silvery flower (diploied) 3	14.087
	CNS0095613	Golden flower (tetraploid) 1	11.272
	CNS0095614	Golden flower (tetraploid) 2	18.105
	CNS0095615	Golden flower (tetraploid) 3	10.236
CRA001975	CRR073297	Stem 1	30.033
	CRR073298	Stem 2	28.540
	CRR073299	Stem 3	34.004
	CRR073300	Leaf 1	27.380
	CRR073301	Leaf 2	29.388
	CRR073302	Leaf 3	35.877
	CRR073303	Juvenile bud 1	37.040
	CRR073304	Juvenile bud 2	14.254
	CRR073305	Juvenile bud 3	28.879
	CRR073306	Third green 1	1.129
	CRR073307	Third green 2	1.194
	CRR073308	Third green 3	3.811
	CRR073309	Second white 1	3.509
	CRR073310	Second white 2	4.365
	CRR073311	Second white 3	4.173
	CRR073312	Silver flowering 1	4.733
	CRR073313	Silver flowering 2	2.644
	CRR073314	Silver flowering 3	1.562
	CRR073315	Gold flowering 1	20.409
	CRR073316	Gold flowering 2	20.762
	CRR073317	Gold flowering 3	16.820
	CRR073318	Tawny withering 1	26.631
	CRR073319	Tawny withering 2	28.711
	CRR073320	Tawny withering 3	29.461