Gene detail

Detail information of GWHGAAZE009135

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010244954.1	3.50389E-97	PREDICTED: proteasome subunit beta type-4 [Nelumbo nucifera]
Swissprot	tr\|Q7DLR9\|PSB4_ARATH	1E-89	Proteasome subunit beta type-4 (Precursor)
trEMBL	tr\|M1AE64\|M1AE64_SOLTU	1E-96	Proteasome subunit beta type {ECO:0000256\|RuleBase:RU004203}
TAIR10	AT1G56450.1	6E-72	20S proteasome beta subunit G1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	103383979	103390148	+
GWHAAZE00000002	mRNA	103383979	103390148	+
GWHAAZE00000002	exon	103383979	103384090	+
GWHAAZE00000002	exon	103389515	103389644	+
GWHAAZE00000002	exon	103389779	103389938	+
GWHAAZE00000002	exon	103390023	103390148	+
GWHAAZE00000002	CDS	103383979	103384090	+
GWHAAZE00000002	CDS	103389515	103389644	+
GWHAAZE00000002	CDS	103389779	103389938	+
GWHAAZE00000002	CDS	103390023	103390148	+

Transcript Sequence
>GWHTAAZE009145 TACCCATATGTGACAGGCACATCTGTGCTTGGCATCAAATACAAAGATGGTATTCTTATGGCTGCCGATATGGGAGGTCAGATGCTTAACTCATATATGCCAAAATTGTCATGGTCATATGGTTCTACCTTGCGATACAAGAATGTGGAGCGAATGAAGCCAGTTGGGAAGCACTCTCTTATTGGTGCAAGTGGAGAAATTAGCGATTTTCAAGAGATTATGCGTTCTCTTGACAACCTTATCTTGTATGACAATATTTGCGATGATGGAAATTCCTTGGGCCCTAAAGAGGTCCACAACTATTTAACTCATATGATGTACAACCGTCGCAACAAATTCGACCCTTTGTGGAATTCACTTGTACATGGTGGAGTGAAAAATGGACAGAAGTATCTTGGATCGGTTAGTATAATCGGTGTACATTATGAGGACAATCATGTTGCCACTGGATTTGGAAATCAACTTGTGCGGCCAATTTTCAGTGATGAATGGCACGAGAACATGAGTTTCGAGGATGGTGTTAAGTAA

Network for GWHGAAZE009135

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00227.27	Proteasome	5	175	3.20E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02736	PSMB4	Proteasome	map03050

Gene Ontology

GO term	Ontology	Name
GO:0051603	biological_process	proteolysis involved in cellular protein catabolic process
GO:0005839	cellular_component	proteasome core complex
GO:0004298	molecular_function	threonine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.151
	SRR3591713	Yellow flower	0.150
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.017
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.072
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.088
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (diploied) 1	0.077
	CNS0095611	Silvery flower (diploied) 2	0.000
	CNS0095612	Silvery flower (diploied) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.075
	CRR073298	Stem 2	0.022
	CRR073299	Stem 3	0.210
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.008
	CRR073302	Leaf 3	0.105
	CRR073303	Juvenile bud 1	0.008
	CRR073304	Juvenile bud 2	0.025
	CRR073305	Juvenile bud 3	0.008
	CRR073306	Third green 1	0.008
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.006
	CRR073309	Second white 1	0.027
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.017
	CRR073313	Silver flowering 2	0.009
	CRR073314	Silver flowering 3	0.124
	CRR073315	Gold flowering 1	0.015
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.009
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.007