Gene detail

Detail information of GWHGAAZE024637

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDY69258.1	4.4594E-132	BnaAnng29850D [Brassica napus]
COG	NP_126298.1	1E-41	proteasome subunit alpha
Swissprot	tr\|F4JJE5\|PSA4B_ARATH	3E-131	Putative proteasome subunit alpha type-4-B
trEMBL	tr\|A0A078JP00\|A0A078JP00_BRANA	2E-132	BnaAnng29850D protein {ECO:0000313\|EMBL:CDY69258.1}
TAIR10	AT4G15165.1	9E-96	N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	46699141	46699890	-
GWHAAZE00000007	mRNA	46699141	46699890	-
GWHAAZE00000007	exon	46699605	46699890	-
GWHAAZE00000007	exon	46699141	46699478	-
GWHAAZE00000007	CDS	46699605	46699890	-
GWHAAZE00000007	CDS	46699141	46699478	-

Transcript Sequence
>GWHTAAZE024671 ATGTCTCGAAGGTATGACAGCCGCACGACGATCTTCTCCCCCGAAGGTCGTCTCTACCAGGTCGAATACGCAATGGAGGCCATTGGAAATGCAGGGTCCGCAATCGGCATACTCTCCAAGGATGGCGTAGTATTAGTTGGTGAAAAGAAAGTCACTTCCAAGCTCCTCCAAACCTCGACCTCGACCGAGAAAATGTACAAAATCGACGACCACTTAGCCTGTGCCGTTGCCGGAATAATGTCCGATGCCAACATCCTTATCAACACAGCCCGGGTCCAAGCCCAGCGTTGGGATAAGAATTACGGGTTCCAGCTTTATATGAGCGACCCGAGCGGCAACTATGGTGGTTGGAAGGCGGCAGCTATCGGAGCGAATAATCAGGCGGCACAGTCGATGCTGAAGCAGGATTATAAGGATGATATTACGCGTGAGGAGGCGGTACAGCTGGCGCTCAAGGTTCTTAGCAAGACTATGGATAGCACTAGCCTTACCTCAGATAAGCTTGAATTGGCTGAAGTTTTCGTGTCCTCGGGGAAAGTGAAGTACCAGGTTTGTTCGCCGGGTGCGCTGAGCAAGATGTTGGTAAAGTATGGTGTGACTCAGCCTGTGCCTGAGAGCTCTTAA

Network for GWHGAAZE024637

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF10584.10	Proteasome_A_N	5	27	1.30E-13
PF00227.27	Proteasome	97	172	1.20E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02728	PSMA4	Proteasome	map03050

Gene Ontology

GO term	Ontology	Name
GO:0051603	biological_process	proteolysis involved in cellular protein catabolic process
GO:0006511	biological_process	ubiquitin-dependent protein catabolic process
GO:0005839	cellular_component	proteasome core complex
GO:0019773	cellular_component	proteasome core complex, alpha-subunit complex
GO:0004298	molecular_function	threonine-type endopeptidase activity
GO:0004175	molecular_function	endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	33.129
	SRR3591706	second leaf	22.374
	SRR3591707	mature leaf	35.363
	SRR3591708	Shoot apex	35.608
	SRR3591709	Stem	41.530
	SRR3591710	White floral bud	129.488
	SRR3591711	White flower	214.081
	SRR3591712	Green floral bud	69.256
	SRR3591713	Yellow flower	165.480
SRP173429	SRR8316895	Juvenile bud stage	74.741
	SRR8316896	Juvenile bud stage	121.518
	SRR8316897	Juvenile bud stage	34.974
	SRR8316894	Third green stage	26.412
	SRR8316900	Third green stage	127.093
	SRR8316901	Third green stage	133.134
	SRR8316898	Complete white stage	113.043
	SRR8316899	Complete white stage	244.301
	SRR8316903	Complete white stage	173.736
	SRR8316902	Silver flowering stage	180.192
	SRR8316904	Silver flowering stage	180.079
	SRR8316905	Silver flowering stage	123.850
	SRR8316906	Gold flowering stage	370.167
	SRR8316907	Gold flowering stage	417.848
	SRR8316908	Gold flowering stage	326.541
SRP132670	SRR6706286	Control	137.219
	SRR6706287	Light intensity 50%	139.815
	SRR6706288	Light intensity 20%	148.584
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	83.348
	CNS0095593	Slightly white alabastrum(diploid) 2	91.877
	CNS0095594	Slightly white alabastrum(diploid) 3	90.419
	CNS0095595	Whole white alabastrum(diploid) 2	86.973
	CNS0095596	Whole white alabastrum(diploid) 3	66.483
	CNS0095597	Whole white alabastrum(diploid) 4	81.475
	CNS0095598	Silvery flower (diploied) 1	175.159
	CNS0095599	Silvery flower (diploied) 2	203.200
	CNS0095600	Silvery flower (diploied) 3	369.830
	CNS0095601	Golden flower (diploid) 1	209.234
	CNS0095602	Golden flower (diploid) 2	321.163
	CNS0095603	Golden flower (diploid) 3	290.694
	CNS0095604	Slightly white alabastrum(tetraploid) 1	97.950
	CNS0095605	Slightly white alabastrum(tetraploid) 2	85.577
	CNS0095606	Slightly white alabastrum(tetraploid) 3	154.222
	CNS0095607	Whole white alabastrum(tetraploid) 1	67.390
	CNS0095608	Whole white alabastrum(tetraploid) 2	65.333
	CNS0095609	Whole white alabastrum(tetraploid) 3	145.795
	CNS0095610	Silvery flower (diploied) 1	492.801
	CNS0095611	Silvery flower (diploied) 2	489.160
	CNS0095612	Silvery flower (diploied) 3	531.435
	CNS0095613	Golden flower (tetraploid) 1	399.848
	CNS0095614	Golden flower (tetraploid) 2	449.494
	CNS0095615	Golden flower (tetraploid) 3	338.820
CRA001975	CRR073297	Stem 1	68.232
	CRR073298	Stem 2	76.086
	CRR073299	Stem 3	93.795
	CRR073300	Leaf 1	104.047
	CRR073301	Leaf 2	106.999
	CRR073302	Leaf 3	112.142
	CRR073303	Juvenile bud 1	152.321
	CRR073304	Juvenile bud 2	180.717
	CRR073305	Juvenile bud 3	182.007
	CRR073306	Third green 1	323.684
	CRR073307	Third green 2	255.723
	CRR073308	Third green 3	260.959
	CRR073309	Second white 1	458.169
	CRR073310	Second white 2	366.992
	CRR073311	Second white 3	282.168
	CRR073312	Silver flowering 1	242.732
	CRR073313	Silver flowering 2	273.604
	CRR073314	Silver flowering 3	197.439
	CRR073315	Gold flowering 1	85.983
	CRR073316	Gold flowering 2	94.032
	CRR073317	Gold flowering 3	92.992
	CRR073318	Tawny withering 1	102.951
	CRR073319	Tawny withering 2	86.681
	CRR073320	Tawny withering 3	93.092