miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR156-2 | scaffold_3068177 | 7988 | 7967 | - |
| precursor | cro-MIR156-2 | scaffold_3068177 | 8010 | 7875 | - |
Sequence and structure information
Mature sequence[cro-miR156-2] GGUGACAGAUAGAGAGUGAGCA | |
Stem-loop sequence[cro-MIR156-2] GAGAGAGAAAGAGAGUGGGUGGGGUGACAGAUAGAGAGUGAGCACGCAUAGCUUCAAGCAUGGGGAAUCAUAUUAUGCAAGAAAACCACCAUGUGUGCUCACUCUCUUCUGUCACCUCCAGCUUAAUUACCCUUUU | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T011065 |
| Rhamnogalacturonate lyase family protein | 3 | psRNATarget[Detail] | |||||||||||||||
| CRO_T012520 |
| RAB GTPase homolog A4D | 2.5 | psRNATarget[Detail] | |||||||||||||||
| CRO_T032641 |
| photosystem II reaction center W | 3 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 105.61 |
| seedling | MeJA treatment 1h | 108.39 |
| seedling | MeJA treatment 8h | 58.42 |
| seedling | MeJA treatment 24h | 105.69 |