miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR160g | scaffold_3051564 | 5313 | 5333 | + |
| precursor | cro-MIR160g | scaffold_3051564 | 5308 | 5402 | + |
Sequence and structure information
Mature sequence[cro-miR160g] UGCCUGGCUCCCUGUAUGCCA | |
Stem-loop sequence[cro-MIR160g] GGAUGUGCCUGGCUCCCUGUAUGCCACACUCAUACACCACUCUCCAUAUUUGAGGAUUUUGUGUUGCGAGUGGCGUGCAAGGGGCCAAGCAUACC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T007962 |
| auxin response factor | 0 | psRNATarget[Detail] | |||||||||||||||
| CRO_T023928 |
| auxin response factor | 1 | psRNATarget[Detail] | |||||||||||||||
| CRO_T027146 |
| auxin response factor | 0 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 3.74 |
| seedling | MeJA treatment 1h | 2.96 |
| seedling | MeJA treatment 8h | 1.77 |
| seedling | MeJA treatment 24h | 5.13 |