miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR162a-5p | scaffold_3001524 | 26432 | 26411 | - |
| precursor | cro-MIR162a | scaffold_3001524 | 26466 | 26312 | - |
Sequence and structure information
Mature sequence[cro-miR162a-5p] UGGAGGCAGCGGUUCAUCGAUC | |
Stem-loop sequence[cro-MIR162a] UAUGGUGGUGGAGGUGGGGGUUGAGGAGGGACACUGGAGGCAGCGGUUCAUCGAUCUGUUCCCUGAAAUUCAAAAAAAAGAAAAAAGAAGCAUGAACAGGAAUCGAUCGAUAAACCUCUGCAUCCAGCGCUUAAUCCUCUACACCUACAUACAUA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 937.57 |
| seedling | MeJA treatment 1h | 1241.85 |
| seedling | MeJA treatment 8h | 643.87 |
| seedling | MeJA treatment 24h | 1221.29 |