miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR166-1 | scaffold_3038334 | 13004 | 12984 | - |
| precursor | cro-MIR166-1 | scaffold_3038334 | 13054 | 12840 | - |
Sequence and structure information
Mature sequence[cro-miR166-1] GAGGAAUGAAGCCUGGUCCGA | |
Stem-loop sequence[cro-MIR166-1] GAGACGAUAAGUCCUGAAUUUGAUGACAUAUGUGAUGGAAAGUGAGGCGUGAGGAAUGAAGCCUGGUCCGAGAUCUCCAUUACUAUUAUACUUCAAAAAACGAUUCACAAACUAAUUACUUGGUUUGUGAAAGAUGAGAUCUUGGAUCAAACUUCAUUCCAAACACCCCUUUUCCUCCUCCUUCAACCAAAUUGUUCAUCUUGUGCUUCUCUCUC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T024457 |
| hypothetical protein | 0 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 1965.7 |
| seedling | MeJA treatment 1h | 2876.1 |
| seedling | MeJA treatment 8h | 1966.1 |
| seedling | MeJA treatment 24h | 2527.39 |