miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR166-3 | scaffold_2997365 | 8484 | 8464 | - |
| precursor | cro-MIR166-3 | scaffold_2997365 | 8569 | 8459 | - |
Sequence and structure information
Mature sequence[cro-miR166-3] UCGGACCAGGCUUCAUUCCCC | |
Stem-loop sequence[cro-MIR166-3] GUUGAGGGGAAUGUCGUCUGGCUCGAAAUCCUUCAAUGAAGAGAAAGUUCUAAUUAGUGUGAUCAGAUCGAUCUUUUGAAUGAUUUCGGACCAGGCUUCAUUCCCCUCAAC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T004831 |
| ATP binding;nucleic acid binding;helicases | 0 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 1521.43 |
| seedling | MeJA treatment 1h | 1470.33 |
| seedling | MeJA treatment 8h | 804.93 |
| seedling | MeJA treatment 24h | 1170.14 |