miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR168 | scaffold_3011104 | 8153 | 8176 | + |
| precursor | cro-MIR168 | scaffold_3011104 | 8019 | 8196 | + |
Sequence and structure information
Mature sequence[cro-miR168] GCUCCCGCCUUGCAUCAACUGAAU | |
Stem-loop sequence[cro-MIR168] GUGCUUUUGCGGCGGUCUCUAAUUCGCUUGGUGCAGGUCGGGAACUGAUUUGCCUCGCGGCGUCCGAUUGAUUUUGUGUUGCACACGUAUUUCUACGUGAAAGAAUACGCAUCUGUGACGCUUCUGGUAAUUGAGCUCCCGCCUUGCAUCAACUGAAUCGGAGACCGCGGUGAAUAAC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T025437 |
| Glycosyl hydrolase family 85 | 3 | psRNATarget[Detail] | |||||||||||||||
| CRO_T028712 |
| hypothetical protein | 0 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 143.91 |
| seedling | MeJA treatment 1h | 189.21 |
| seedling | MeJA treatment 8h | 115.24 |
| seedling | MeJA treatment 24h | 234.74 |