miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR171c | scaffold_3043744 | 6278 | 6258 | - |
| precursor | cro-MIR171c | scaffold_3043744 | 6397 | 6237 | - |
Sequence and structure information
Mature sequence[cro-miR171c] UGAGCCGAAUCAAUAUCACUC | |
Stem-loop sequence[cro-MIR171c] GAGAGGGAUUAAUAUUUGAGAAGUAGACACGGCGUGAUACUGAUAUCGGCUCAUCAGCAUGCAGUGCAUGUGAAGCAGACUCUGUUUUGCAAAUUGUUAGUUAAUUAGCCGAUCGAUGAUGAGCCGAAUCAAUAUCACUCUUGUAUGCUUUUCCACCUCUU | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T014187 |
| protease-related | 2.5 | psRNATarget[Detail] | |||||||||||||||
| CRO_T032907 |
| GRAS family transcription factor | 1.5 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 3.74 |
| seedling | MeJA treatment 1h | 5.74 |
| seedling | MeJA treatment 8h | 5.37 |
| seedling | MeJA treatment 24h | 10.29 |