miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR319-2 | scaffold_3014220 | 7178 | 7158 | - |
| precursor | cro-MIR319-2 | scaffold_3014220 | 7368 | 7156 | - |
Sequence and structure information
Mature sequence[cro-miR319-2] UUGGACUGAAGGGAGCUCCUU | |
Stem-loop sequence[cro-MIR319-2] AGAAGGAGCUCCUUUCGGUCCAACACCCAGGGCGGAGGAGCAGUGAGAGCUGCCAUUUCAUGCAUUGGGUUAUGCUUUGGUGUUUUUGUGUUUCUUUGUGACAAAAAGCGGUGGGCUGCCGGAAUUGAAAUGCAAAGCUUAACCAGUGCAUGGUGAGGGAGCAACUCCUCCUGCCAACUUCGCCCGCCCAUUGGACUGAAGGGAGCUCCUUUU | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T017990 |
| nucleic acid binding;ATP-dependent helicases;ATP binding;helicases;ATP-dependent helicases | 2.5 | psRNATarget[Detail] | |||||||||||||||
| CRO_T020459 |
| TEOSINTE BRANCHED 1, cycloidea and PCF transcription factor | 3 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 57.92 |
| seedling | MeJA treatment 1h | 57.89 |
| seedling | MeJA treatment 8h | 32.26 |
| seedling | MeJA treatment 24h | 62.54 |