miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR319-3 | scaffold_3026979 | 958 | 939 | - |
| precursor | cro-MIR319-3 | scaffold_3026979 | 1006 | 843 | - |
Sequence and structure information
Mature sequence[cro-miR319-3] GGGAGCUCCCUUCAGCCCAA | |
Stem-loop sequence[cro-MIR319-3] GAUUAUUUGUACGGAAAUUAGAGUAGAAAGAAGAGAAAAGUGAACGAAGGGAGCUCCCUUCAGCCCAAGACAUGACAGAAAAAACUGAACAACAGCUCCUGCUGUUGGCCCAGUGGCCCAUUUUCACACUAUUUUCAUUCUUUUUAUUUUUGGCCCAUUUAAUC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 15.25 |
| seedling | MeJA treatment 1h | 13.22 |
| seedling | MeJA treatment 8h | 9.36 |
| seedling | MeJA treatment 24h | 12.03 |