miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR390-3 | scaffold_1136375 | 1913 | 1893 | - |
| precursor | cro-MIR390-3 | scaffold_1136375 | 1931 | 1798 | - |
Sequence and structure information
Mature sequence[cro-miR390-3] AAGCUCAGGAGGGAUAGCGCC | |
Stem-loop sequence[cro-MIR390-3] AGCAGUGGAGGAUCUGCAAAGCUCAGGAGGGAUAGCGCCAUAGAUAAUGAAUGACCGAUGAUCAUCAUCAUUUGGUAAUUCUUCACUUCAUUUGUUGGCGCUAUCUAUCCUGAGUUUCACGGAUCCUUCAUGCU | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T015583 |
| hypothetical protein | 2.5 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 28.81 |
| seedling | MeJA treatment 1h | 26.71 |
| seedling | MeJA treatment 8h | 21.54 |
| seedling | MeJA treatment 24h | 64.52 |