miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR393a-5p | scaffold_3060887 | 57323 | 57302 | - |
| precursor | cro-MIR393a | scaffold_3060887 | 57365 | 57184 | - |
Sequence and structure information
Mature sequence[cro-miR393a-5p] UCCAAAGGGAUCGCAUUGAUCC | |
Stem-loop sequence[cro-MIR393a] AUUUUAGUGGGAAGAUUUCUACAACUGCAACUGAAGGAGGCAUCCAAAGGGAUCGCAUUGAUCCCCAAAUUAAUAAAUGGAAAUUAUUAGUGCAUGUAUUGUAUGGUGAAUUGGGAUCAUGCUAUCCCUUUGGAUACCUCCUUUGGUAGCUAAAAGAUUGAUGACAUCAUCCGGCCGGAAAU | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T001460 |
| F-box/RNI-like superfamily protein | 3 | psRNATarget[Detail] | |||||||||||||||
| CRO_T011549 |
| auxin signaling F-box | 1 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 68.28 |
| seedling | MeJA treatment 1h | 50.95 |
| seedling | MeJA treatment 8h | 20.5 |
| seedling | MeJA treatment 24h | 45.62 |