miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR394 | scaffold_3052341 | 24606 | 24627 | + |
| precursor | cro-MIR394 | scaffold_3052341 | 24577 | 24689 | + |
Sequence and structure information
Mature sequence[cro-miR394] UUGGCAUUCUGUCCACCUCCGU | |
Stem-loop sequence[cro-MIR394] CAGGAGAGGAUAGAUGUUGCAGAAAGAAUUUGGCAUUCUGUCCACCUCCGUCAAGUAUAUACCUAGCUUGGAGGGGGCCAGCAUGUCAAAUUGGCUCUGCAUAUCUUCAUCUG | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T010920 |
| Galactose oxidase/kelch repeat superfamily protein | 1 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 55.36 |
| seedling | MeJA treatment 1h | 22.55 |
| seedling | MeJA treatment 8h | 9.48 |
| seedling | MeJA treatment 24h | 41.06 |