miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR395-3 | scaffold_2989192 | 51779 | 51758 | - |
| precursor | cro-MIR395-3 | scaffold_2989192 | 51846 | 51744 | - |
Sequence and structure information
Mature sequence[cro-miR395-3] CUGAAGUGUUUGGGGGAACUCC | |
Stem-loop sequence[cro-MIR395-3] GUCAGGCUUCUCCUAGAGUUCCCUUGACCACUUCACUGGGGGACAAUUGCCCCUAAUAUUAGCCCCACUGAAGUGUUUGGGGGAACUCCGGUAGCCACCUGAC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T026783 |
| slufate transporter 2;1 | 2 | psRNATarget[Detail] | |||||||||||||||
| CRO_T026783 |
| slufate transporter 2;1 | 2.5 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 94.51 |
| seedling | MeJA treatment 1h | 91.21 |
| seedling | MeJA treatment 8h | 41.32 |
| seedling | MeJA treatment 24h | 79.47 |