miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR398a-3p | scaffold_2976638 | 11105 | 11085 | - |
| precursor | cro-MIR398a | scaffold_2976638 | 11185 | 11069 | - |
Sequence and structure information
Mature sequence[cro-miR398a-3p] UGUGUUCUCAGGUCGCCCCUG | |
Stem-loop sequence[cro-MIR398a] AGUGAAAGUUUCCAAUAGGGUCGACAUGAGAUCACAUUUUCACGUUAUUUUUCAGAUAGAAUUCUCAAGUGUGAAUAAAAUGUGUUCUCAGGUCGCCCCUGUAGGAAUCUCUUUACU | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T004502 |
| uclacyanin | 2.5 | psRNATarget[Detail] | |||||||||||||||
| CRO_T031123 |
| appr-1-p processing enzyme family protein | 1 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 831.78 |
| seedling | MeJA treatment 1h | 454.56 |
| seedling | MeJA treatment 8h | 85.04 |
| seedling | MeJA treatment 24h | 288.78 |