miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR399-3 | scaffold_3019923 | 484 | 504 | + |
| precursor | cro-MIR399-3 | scaffold_3019923 | 459 | 595 | + |
Sequence and structure information
Mature sequence[cro-miR399-3] CAGGGCAAUUCUCCUUUGGCA | |
Stem-loop sequence[cro-MIR399-3] GCACUAGGACUGUGAGAGGGAAUGGCAGGGCAAUUCUCCUUUGGCACAGUGUACUGGACAAGUAUAAGUUGUUUGUAGCCGUGCAUGCCAAAGGAGAAUUACACUGUUAUUCAAAACUCCACAUUAUCAUCAUCUGC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T005219 |
| Eukaryotic aspartyl protease family protein | 2.5 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 3.47 |
| seedling | MeJA treatment 1h | 1.97 |
| seedling | MeJA treatment 8h | 1.61 |
| seedling | MeJA treatment 24h | 6.25 |