miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR399-7 | scaffold_2957688 | 9446 | 9426 | - |
| precursor | cro-MIR399-7 | scaffold_2957688 | 9479 | 9281 | - |
Sequence and structure information
Mature sequence[cro-miR399-7] UGCCAAAGGAGAAUUGCCCUG | |
Stem-loop sequence[cro-MIR399-7] CAUGCAUGUGUAUAUAUAAUUAAUUUUCCUUUUUGCCAAAGGAGAAUUGCCCUGCAAUUCAGUCUCGCACUGCAGCUAGCUAGCGCUUCUUGAGAUCCAUCAUAAAACGUUUCUAAUCUUGCUGUACAUACGUAGUUAAGGUUUGAUUUUAAAUCUCUGGGAAAAAUAUUCGGAUCAGUUAUAUAUAUAUAUAUAUAUG | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T009850 |
| phosphate | 1.5 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 7.36 |
| seedling | MeJA treatment 1h | 5.69 |
| seedling | MeJA treatment 8h | 3.91 |
| seedling | MeJA treatment 24h | 7.3 |