miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-miR8016 | scaffold_3068655 | 3564 | 3587 | + |
| precursor | cro-MIR8016 | scaffold_3068655 | 3462 | 3608 | + |
Sequence and structure information
Mature sequence[cro-miR8016] AUUUUUGAAUAGAAGGCCCAUGUG | |
Stem-loop sequence[cro-MIR8016] CAACUUCAUGAUCUUGAUUCGCAUGGUCCUUUUAUUCAAAAAUAUAUUUGUUUGCAUCAUCUUUCAAAGGAAUGAAAGUUGUUGCAUCAUUAUAUCAAAUAUAUUUUUGAAUAGAAGGCCCAUGUGUGUCAUUAUCUUGAAACUUUG | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 274.61 |
| seedling | MeJA treatment 1h | 328.13 |
| seedling | MeJA treatment 8h | 185.39 |
| seedling | MeJA treatment 24h | 343.37 |