miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-103 | scaffold_3019032 | 12347 | 12370 | + |
| precursor | cro-NOVEL-103 | scaffold_3019032 | 12254 | 12396 | + |
Sequence and structure information
Mature sequence[cro-novel-103] AUUUAAGUAGUAUUUGUGGUUCCC | |
Stem-loop sequence[cro-NOVEL-103] AGAGUUCAAAUUUCUCUUAUGAUAUACGUUUAUUACAUAGCUUGCUUAAUGCAAUACAUUCUUAUAUAAUUUGAGGAUUAUUAUAUAAGACGAAUUUAAGUAGUAUUUGUGGUUCCCUUGUCAAUAGAAGAAAAAACAACUCA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T021331 |
| D-isomer specific 2-hydroxyacid dehydrogenase family protein | 2.5 | psRNATarget[Detail] | |||||||||||||||
| CRO_T021332 |
| D-isomer specific 2-hydroxyacid dehydrogenase family protein | 2.5 | psRNATarget[Detail] | |||||||||||||||
| CRO_T023747 |
| hypothetical protein | 2.5 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 7.36 |
| seedling | MeJA treatment 1h | 7.79 |
| seedling | MeJA treatment 8h | 10.84 |
| seedling | MeJA treatment 24h | 24.54 |