miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-107 | scaffold_3044054 | 5339 | 5320 | - |
| precursor | cro-NOVEL-107 | scaffold_3044054 | 5441 | 5307 | - |
Sequence and structure information
Mature sequence[cro-novel-107] AUUGGAUUGAAGGGAGCUCU | |
Stem-loop sequence[cro-NOVEL-107] GUGCUUCUUGAAUUUUGGCACCCUGUAUUCCACUACUUUCUAUAUCCAUUUUAUGUACAUUAAUCUUCACUUCCUGUAUUUGCCUGGGAGUAUUUUCUGAGUAUUGGAUUGAAGGGAGCUCUGACUUAACUGCAA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T009355 |
| myb domain protein | 0 | psRNATarget[Detail] | |||||||||||||||
| CRO_T018593 |
| myb domain protein | 2.5 | psRNATarget[Detail] | |||||||||||||||
| CRO_T023538 |
| RING/U-box superfamily protein | 2 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 9383.53 |
| seedling | MeJA treatment 1h | 12938.53 |
| seedling | MeJA treatment 8h | 15466.54 |
| seedling | MeJA treatment 24h | 13045.78 |