miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-112 | scaffold_3061966 | 42173 | 42150 | - |
| precursor | cro-NOVEL-112 | scaffold_3061966 | 42185 | 42089 | - |
Sequence and structure information
Mature sequence[cro-novel-112] AAGGACAGAAUCAAAAGGAACAUG | |
Stem-loop sequence[cro-NOVEL-112] UGACUAAAAUGCAAGGACAGAAUCAAAAGGAACAUGACAGAAUAAAAGUUGUGGUUCUGUUUAUAGCGUUUUGUUUAUUGUUCGAUGAUUUUGGUUU | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T022506 |
| transcriptional coactivator p15 (PC4) family protein (KELP) | 2 | psRNATarget[Detail] | |||||||||||||||
| CRO_T032089 |
| Peroxidase superfamily protein | 2.5 | psRNATarget[Detail] | |||||||||||||||
| CRO_T032641 |
| photosystem II reaction center W | 2 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 15.43 |
| seedling | MeJA treatment 1h | 14.1 |
| seedling | MeJA treatment 8h | 17.53 |
| seedling | MeJA treatment 24h | 18.01 |