miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-113 | scaffold_3068374 | 20993 | 20970 | - |
| precursor | cro-NOVEL-113 | scaffold_3068374 | 21000 | 20900 | - |
Sequence and structure information
Mature sequence[cro-novel-113] AAGAGACGUGUAUGUGUUGAGAAU | |
Stem-loop sequence[cro-NOVEL-113] UUACUUUAAGAGACGUGUAUGUGUUGAGAAUCUCAUACGGCUAGUAUUUAAGAAAUGCUUACUGCUUAUAAAGUCUUAGGCAUCCUCCCCUCUUGAAGUAU | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 24.75 |
| seedling | MeJA treatment 1h | 23.74 |
| seedling | MeJA treatment 8h | 28.39 |
| seedling | MeJA treatment 24h | 26.35 |