miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-119 | scaffold_2980235 | 62116 | 62139 | + |
| precursor | cro-NOVEL-119 | scaffold_2980235 | 62105 | 62185 | + |
Sequence and structure information
Mature sequence[cro-novel-119] AAUUGUCUUGUAGCAUUCAGAGGU | |
Stem-loop sequence[cro-NOVEL-119] CAGUACGCAUUAAUUGUCUUGUAGCAUUCAGAGGUCAGGGACUAAAUCACAGUUGUGUGUUGCGAACAUUUGUGUGUACUA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 3.66 |
| seedling | MeJA treatment 1h | 3.76 |
| seedling | MeJA treatment 8h | 2.96 |
| seedling | MeJA treatment 24h | 2.75 |