miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-121 | scaffold_3033859 | 10079 | 10056 | - |
| precursor | cro-NOVEL-121 | scaffold_3033859 | 10136 | 10053 | - |
Sequence and structure information
Mature sequence[cro-novel-121] AGGAGAUCGCGUAAUUGGAUUACA | |
Stem-loop sequence[cro-NOVEL-121] UUGUGUGAUUCGAACUCAAAAUCUUUCACUUGAUAGCUAAAUGAAAGUAUUUAAGUAAGGAGAUCGCGUAAUUGGAUUACACAC | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 11.08 |
| seedling | MeJA treatment 1h | 3.93 |
| seedling | MeJA treatment 8h | 7.1 |
| seedling | MeJA treatment 24h | 7.54 |