miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-122 | scaffold_3064978 | 40964 | 40941 | - |
| precursor | cro-NOVEL-122 | scaffold_3064978 | 40995 | 40887 | - |
Sequence and structure information
Mature sequence[cro-novel-122] GAACGGCUGGUUAGUCUCUAUUUC | |
Stem-loop sequence[cro-NOVEL-122] CGAUGUAGUUGCUAUUUUAAAAAUAAUUUUCGAACGGCUGGUUAGUCUCUAUUUCGCACAAACUUGUAAAAAAUAAUGAUCGACUUAGUAUUCGGUUGCAACUCGGUCA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 8.15 |
| seedling | MeJA treatment 1h | 10.31 |
| seedling | MeJA treatment 8h | 14.15 |
| seedling | MeJA treatment 24h | 19.39 |