miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-126 | scaffold_3058488 | 39233 | 39256 | + |
| precursor | cro-NOVEL-126 | scaffold_3058488 | 39230 | 39425 | + |
Sequence and structure information
Mature sequence[cro-novel-126] ACGGUCCUACCUAAGAAAUGAGAA | |
Stem-loop sequence[cro-NOVEL-126] AGAACGGUCCUACCUAAGAAAUGAGAAGAAUAUUUCUUUCCCUUUUAAAAUUAAAAAAAAAAAAAACUAGUAUAAUAUAUAUCUAUUUGAGUCGUAAAAUUAGCCGCUAGCACCAUCUCUCUAAGUCUUUCAAAAUUUUAUAAUAUAAGAUACUUUUAUUCUUUUAAGUCUUAUUUUUUUGGCGGUACUAUGUUUA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 12.18 |
| seedling | MeJA treatment 1h | 10.53 |
| seedling | MeJA treatment 8h | 8.56 |
| seedling | MeJA treatment 24h | 105.5 |