miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-129 | scaffold_3055304 | 58484 | 58461 | - |
| precursor | cro-NOVEL-129 | scaffold_3055304 | 58486 | 58411 | - |
Sequence and structure information
Mature sequence[cro-novel-129] ACGAUCUUGCACCUGACAUGCUAA | |
Stem-loop sequence[cro-NOVEL-129] UUACGAUCUUGCACCUGACAUGCUAAGUGAAAGAUUUUGAGUUCAAGUCACUUAUAGAGCAGGUUUAAUAUCGUAU | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 8.79 |
| seedling | MeJA treatment 1h | 6.08 |
| seedling | MeJA treatment 8h | 6.08 |
| seedling | MeJA treatment 24h | 4.27 |