miRNA detailed information
miRNA detail image
Location informaition
| Type | ID | Scaffold | Start | End | Strand |
|---|---|---|---|---|---|
| mature | cro-novel-13 | scaffold_3069926 | 64229 | 64252 | + |
| precursor | cro-NOVEL-13 | scaffold_3069926 | 64024 | 64323 | + |
Sequence and structure information
Mature sequence[cro-novel-13] AUUAGUGGCUGGACAAUUUUAUCC | |
Stem-loop sequence[cro-NOVEL-13] CCUUAUACGACAAUGAUAGAUAAUUUUUUGCUAAUUUAUAUCGCAUGACAUUUACAUGUCAUCUUUAUACUAAGGAUAAAAUCGUCUAACUAUUAAUUUAAGUCCCAAUCCAUCACUGGAAUGGGUCAAAAUGAACUUGUCAAUGUUUUGUAUCGGCACAUAAGUCGAAUUAUUUCAAAGCAUUCCAAUUGUUGAUUAGUGUUAUAUUAGUGGCUGGACAAUUUUAUCCUUACUAAAGAUAAUAUUUGAAUGUCAUGUAAUACAAAUUGGACAGAAAUCACCUAUCAUCGCCGUAUAAGA | |
Secondary structure of stem-loop sequence 
To make high resolution picture for your own, please download the .ps file. |
miRNA target information
| Target gene | Alignment | Annotation | Expection | Method | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRO_T006735 |
| Undecaprenyl pyrophosphate synthetase family protein | 2.5 | psRNATarget[Detail] | |||||||||||||||
| CRO_T021690 |
| subtilase family protein | 1.5 | psRNATarget[Detail] | |||||||||||||||
| CRO_T033295 |
| S-adenosyl-L-methionine-dependent methyltransferases superfamily protein | 0 | psRNATarget[Detail] |
Expression pattern
| Tissue | Treat | FPKM value |
|---|---|---|
| seedling | control | 67.21 |
| seedling | MeJA treatment 1h | 75.42 |
| seedling | MeJA treatment 8h | 91.28 |
| seedling | MeJA treatment 24h | 41.79 |